Mutagenetix > Incidental Mutation

Incidental Mutation 'R4772:Adamts19'

367639

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4772 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58837776 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 144 (Q144R)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052907
AA Change: Q144R

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: Q144R

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Meta Mutation Damage Score

0.0729

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

95% (74/78)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,315,339		probably null	Het
Adgrb3	C	A	1: 25,531,875	C507F	probably damaging	Het
Atg9b	T	C	5: 24,385,239	*923W	probably null	Het
Atp13a4	T	C	16: 29,420,835		probably benign	Het
Baz2b	G	T	2: 59,958,451	R697S	probably damaging	Het
Bicdl1	A	G	5: 115,661,478	I184T	probably benign	Het
Bpifb4	C	T	2: 153,942,983	L204F	possibly damaging	Het
Cep120	C	T	18: 53,718,489	R577Q	probably damaging	Het
Cplx4	T	C	18: 65,969,977	E24G	possibly damaging	Het
D430042O09Rik	A	G	7: 125,865,351	S1297G	probably damaging	Het
Dcxr	T	C	11: 120,726,097	T147A	probably benign	Het
Dnajc10	C	A	2: 80,340,526	H454N	probably damaging	Het
Dsp	G	T	13: 38,167,528	G108*	probably null	Het
Entpd6	T	A	2: 150,767,094	I366K	probably damaging	Het
Fam111a	A	G	19: 12,587,693	K269E	probably benign	Het
Grid2ip	T	G	5: 143,375,700	V222G	possibly damaging	Het
Hmcn2	T	G	2: 31,445,314	V4421G	probably benign	Het
Ifi207	T	C	1: 173,727,687	T817A	probably damaging	Het
Irak2	A	T	6: 113,693,722	E533V	probably damaging	Het
Kbtbd6	T	C	14: 79,452,156	F97S	probably damaging	Het
Kctd14	A	T	7: 97,457,676	E99V	probably damaging	Het
Klhl10	A	T	11: 100,447,731	Y432F	probably benign	Het
Lrrc49	T	C	9: 60,685,052	N53S	possibly damaging	Het
Mief2	T	A	11: 60,730,462		probably benign	Het
Mog	A	T	17: 37,023,157	S15T	unknown	Het
Mpi	T	C	9: 57,544,898	D365G	probably damaging	Het
Mpp7	A	G	18: 7,379,983		probably null	Het
Nes	A	G	3: 87,976,179	T582A	probably benign	Het
Nlrp14	A	G	7: 107,181,186	D5G	probably benign	Het
Nr1i3	C	T	1: 171,217,150	T218I	probably damaging	Het
Nup43	C	T	10: 7,678,669	R339*	probably null	Het
Nupl1	T	A	14: 60,220,022	R577S	probably benign	Het
Olfr1016	G	A	2: 85,799,994	S92F	probably damaging	Het
Olfr1161	T	A	2: 88,024,863	I47K	probably damaging	Het
Olfr503	T	A	7: 108,544,885	M120K	probably damaging	Het
Olfr724	AAATTTGAA	AAA	14: 49,960,995		probably benign	Het
Olfr768	A	T	10: 129,093,668	V102D	possibly damaging	Het
Olfr908	C	T	9: 38,516,601		probably benign	Het
Orc1	T	C	4: 108,579,568		probably benign	Het
Pax6	C	A	2: 105,696,502	P251Q	probably benign	Het
Phactr3	C	T	2: 178,283,936	R330W	probably damaging	Het
Phldb1	G	A	9: 44,711,027	R81W	probably damaging	Het
Pip5k1c	C	T	10: 81,315,940	P656L	probably benign	Het
Pkn3	T	G	2: 30,084,680		probably null	Het
Plcb2	T	A	2: 118,713,134	H752L	probably benign	Het
Plch1	G	A	3: 63,753,325	T291M	probably damaging	Het
Plekhg1	A	T	10: 3,873,127	M32L	probably benign	Het
Plekhg1	A	T	10: 3,873,130	T33S	probably damaging	Het
Plk4	A	G	3: 40,805,190	T174A	probably damaging	Het
Ppip5k2	C	A	1: 97,721,067		probably benign	Het
Prl2a1	G	A	13: 27,804,978	V29M	probably benign	Het
R3hcc1l	T	C	19: 42,583,557		probably benign	Het
Rasa3	C	T	8: 13,598,289	G125D	probably damaging	Het
Sema3f	A	T	9: 107,689,720	Y136*	probably null	Het
Slc13a5	T	A	11: 72,250,846		probably null	Het
Slc16a1	T	C	3: 104,653,564	V395A	possibly damaging	Het
Sparcl1	C	T	5: 104,088,490	A466T	probably benign	Het
Srrm1	G	A	4: 135,342,379		probably benign	Het
Styxl1	G	A	5: 135,768,901	R50*	probably null	Het
Tex264	T	A	9: 106,673,702	I99F	possibly damaging	Het
Tgtp2	T	C	11: 49,058,984	T254A	probably damaging	Het
Tmem245	A	C	4: 56,937,989		probably null	Het
Tnik	A	T	3: 28,607,210	T587S	probably benign	Het
Tpr	T	G	1: 150,413,113	S648A	possibly damaging	Het
Ttn	T	C	2: 76,765,969	E18454G	probably damaging	Het
Utp20	A	C	10: 88,809,935	H527Q	probably benign	Het
Vmn1r1	A	T	1: 182,157,546	S185T	probably benign	Het
Vps54	C	T	11: 21,312,952	H680Y	probably damaging	Het
Vwa5b2	A	G	16: 20,600,803		probably null	Het
Wscd1	T	C	11: 71,771,976		probably null	Het
Zbtb41	C	T	1: 139,447,414	P871S	probably damaging	Het
Zcchc4	T	C	5: 52,796,207	L186P	possibly damaging	Het
Zdhhc13	A	G	7: 48,799,873	Y73C	probably benign	Het
Zfp12	A	G	5: 143,240,000	E21G	probably damaging	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- AAGTCGTGTTTCCTGCACTC -3'
(R):5'- CTGTCCCGGTGTAAAAGCAG -3'

Sequencing Primer
(F):5'- AGTCGCTGAACGCCACG -3'
(R):5'- AAGAGCCAGGGTCAGCC -3'

Posted On

2015-12-29