Incidental Mutation 'R4773:Soga1'
ID367655
Institutional Source Beutler Lab
Gene Symbol Soga1
Ensembl Gene ENSMUSG00000055485
Gene Namesuppressor of glucose, autophagy associated 1
SynonymsD430036N24Rik, 9830001H06Rik
MMRRC Submission 042411-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R4773 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location157015799-157079254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 157030569 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 953 (Q953K)
Ref Sequence ENSEMBL: ENSMUSP00000066556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069098]
Predicted Effect probably benign
Transcript: ENSMUST00000069098
AA Change: Q953K

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000066556
Gene: ENSMUSG00000055485
AA Change: Q953K

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
low complexity region 51 66 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
low complexity region 132 148 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
Blast:BRLZ 212 246 4e-8 BLAST
SCOP:d1fxkc_ 216 350 1e-3 SMART
Pfam:DUF3166 378 472 2.3e-31 PFAM
Pfam:DUF3166 504 593 5.3e-31 PFAM
low complexity region 637 649 N/A INTRINSIC
coiled coil region 807 867 N/A INTRINSIC
low complexity region 872 884 N/A INTRINSIC
low complexity region 938 950 N/A INTRINSIC
Pfam:DUF4482 1065 1205 3.9e-28 PFAM
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1363 1377 N/A INTRINSIC
low complexity region 1389 1418 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153229
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (89/89)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,598 probably null Het
9230009I02Rik A G 11: 51,091,262 noncoding transcript Het
Actl7b T C 4: 56,740,972 I129V probably benign Het
Adipor2 A G 6: 119,359,086 L225P probably benign Het
Arhgap25 A G 6: 87,496,071 F35L probably benign Het
Asah2 A T 19: 32,052,858 M138K probably damaging Het
Asxl1 T A 2: 153,401,985 M1486K probably damaging Het
B4galt4 T A 16: 38,752,296 S114R probably benign Het
Brpf3 T G 17: 28,821,259 S885A probably benign Het
Cacna1g G T 11: 94,411,472 H1944N possibly damaging Het
Ccdc110 G A 8: 45,943,208 C712Y probably damaging Het
Ccdc175 A T 12: 72,136,048 I399N probably damaging Het
Cct8l1 A T 5: 25,517,756 T490S probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Copa A G 1: 172,105,220 N371D probably damaging Het
Cpeb1 A T 7: 81,355,947 H381Q probably benign Het
Cyp2d40 T A 15: 82,761,562 I81F possibly damaging Het
Dscc1 A T 15: 55,080,258 D405E probably benign Het
Ece1 A G 4: 137,945,153 D369G probably benign Het
Exd2 T C 12: 80,475,818 V17A possibly damaging Het
Fam111a A T 19: 12,588,408 N507I possibly damaging Het
Flnc T C 6: 29,445,039 V719A possibly damaging Het
Fscb C T 12: 64,473,690 G334D probably damaging Het
Glud1 T C 14: 34,321,825 probably null Het
Gm8126 T A 14: 43,261,615 Y180* probably null Het
Grip2 G A 6: 91,782,432 P347L possibly damaging Het
H60b C T 10: 22,288,745 probably benign Het
Hist1h1d T C 13: 23,555,402 S105P probably damaging Het
Itga6 T C 2: 71,822,444 V217A probably benign Het
Kndc1 G A 7: 139,924,031 W1083* probably null Het
Limch1 A T 5: 67,027,507 D613V probably damaging Het
Lpl T A 8: 68,896,751 C310S probably damaging Het
March1 T A 8: 66,387,224 C220S probably benign Het
Mbd5 A C 2: 49,274,611 H308P probably damaging Het
Med13 T C 11: 86,276,920 D2003G probably damaging Het
Mettl16 T A 11: 74,817,301 V442D possibly damaging Het
Mstn A T 1: 53,062,108 T115S probably benign Het
Nfil3 A G 13: 52,968,014 S285P probably damaging Het
Olfr218 A C 1: 173,204,229 Y291S probably damaging Het
Olfr645 A G 7: 104,084,295 S262P probably damaging Het
Otof A G 5: 30,394,682 V321A probably benign Het
Pcdha8 G T 18: 36,994,573 A703S probably damaging Het
Pcdhb18 A G 18: 37,490,454 Y279C probably damaging Het
Pdgfa T C 5: 138,993,296 D51G probably benign Het
Pdzd8 A G 19: 59,300,860 Y703H probably damaging Het
Pecr G T 1: 72,267,435 P229Q probably damaging Het
Phkg1 G T 5: 129,873,273 probably null Het
Plxnb2 A T 15: 89,166,947 H356Q probably benign Het
Polr1b T C 2: 129,105,328 I191T probably benign Het
Ppp4r3a A G 12: 101,082,767 L35P possibly damaging Het
Rasa2 C T 9: 96,544,417 G792D probably benign Het
Rps11-ps4 T C 12: 51,297,623 noncoding transcript Het
Sema3g A G 14: 31,220,709 D89G probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slfn8 A G 11: 83,017,393 V108A probably damaging Het
Smg9 T A 7: 24,407,594 M221K possibly damaging Het
Sos1 A G 17: 80,398,231 S1304P probably damaging Het
Spert T A 14: 75,583,106 Y393F probably damaging Het
Sqle C A 15: 59,317,839 A110E possibly damaging Het
Stab2 G A 10: 86,907,371 Q1154* probably null Het
Taf4b A G 18: 14,804,520 T217A probably benign Het
Tex15 T C 8: 33,582,732 V2769A probably benign Het
Tmem156 A T 5: 65,080,159 C53S probably damaging Het
Tmtc3 T A 10: 100,457,139 K452N possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tph1 T C 7: 46,656,952 E195G probably damaging Het
Trpc6 T A 9: 8,609,851 Y107N possibly damaging Het
Tsga10 G A 1: 37,835,525 T93I probably damaging Het
Ttc25 C A 11: 100,549,916 N74K probably benign Het
Ttn T A 2: 76,741,434 N26372Y probably damaging Het
Tubd1 T C 11: 86,555,302 L256P possibly damaging Het
Txnrd2 C G 16: 18,440,819 A126G probably benign Het
Vmn1r210 T G 13: 22,827,204 K304T probably benign Het
Vps25 T C 11: 101,258,829 S160P probably benign Het
Vrk3 T A 7: 44,775,476 D438E probably benign Het
Vwa5b1 A G 4: 138,581,755 L708P probably benign Het
Washc3 C T 10: 88,219,262 Q105* probably null Het
Wdr83os T A 8: 85,080,781 probably benign Het
Wwc1 T C 11: 35,867,296 H741R probably benign Het
Zan T C 5: 137,436,313 probably benign Het
Zdhhc4 A T 5: 143,326,176 L14I possibly damaging Het
Zfp568 T A 7: 29,997,770 D38E probably damaging Het
Other mutations in Soga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Soga1 APN 2 157030864 missense probably damaging 1.00
IGL00924:Soga1 APN 2 157040705 missense probably damaging 0.99
IGL01723:Soga1 APN 2 157030614 missense probably benign 0.00
IGL01749:Soga1 APN 2 157021541 splice site probably benign
IGL02199:Soga1 APN 2 157030945 missense probably damaging 1.00
IGL02262:Soga1 APN 2 157030906 missense probably damaging 1.00
IGL02618:Soga1 APN 2 157040566 missense probably damaging 1.00
IGL02643:Soga1 APN 2 157040743 missense probably damaging 1.00
deglutition UTSW 2 157039864 missense possibly damaging 0.63
gulp UTSW 2 157023817 nonsense probably null
IGL02835:Soga1 UTSW 2 157041934 missense possibly damaging 0.91
R0528:Soga1 UTSW 2 157020692 missense probably damaging 1.00
R0535:Soga1 UTSW 2 157033289 missense possibly damaging 0.89
R0726:Soga1 UTSW 2 157060262 missense probably damaging 1.00
R1473:Soga1 UTSW 2 157020448 nonsense probably null
R1589:Soga1 UTSW 2 157027637 missense probably benign 0.05
R1615:Soga1 UTSW 2 157020743 missense probably damaging 1.00
R1681:Soga1 UTSW 2 157030530 missense possibly damaging 0.70
R1701:Soga1 UTSW 2 157030619 missense probably damaging 1.00
R1872:Soga1 UTSW 2 157040261 missense possibly damaging 0.88
R2056:Soga1 UTSW 2 157022827 missense probably benign 0.00
R2118:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2120:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2121:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2124:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2249:Soga1 UTSW 2 157040093 missense probably benign 0.08
R3147:Soga1 UTSW 2 157020364 missense possibly damaging 0.91
R3758:Soga1 UTSW 2 157020638 missense possibly damaging 0.77
R4601:Soga1 UTSW 2 157039924 missense probably benign 0.41
R4646:Soga1 UTSW 2 157020506 missense probably damaging 1.00
R4653:Soga1 UTSW 2 157040591 missense probably damaging 1.00
R4736:Soga1 UTSW 2 157020554 missense probably damaging 1.00
R4796:Soga1 UTSW 2 157020252 missense probably benign
R4999:Soga1 UTSW 2 157022856 missense probably benign 0.10
R5304:Soga1 UTSW 2 157023817 nonsense probably null
R5369:Soga1 UTSW 2 157040734 missense probably damaging 1.00
R5530:Soga1 UTSW 2 157020342 missense probably damaging 1.00
R5712:Soga1 UTSW 2 157030921 missense probably damaging 1.00
R5780:Soga1 UTSW 2 157018490 missense probably damaging 0.98
R6162:Soga1 UTSW 2 157039864 missense possibly damaging 0.63
R6253:Soga1 UTSW 2 157021419 missense probably benign 0.00
R6303:Soga1 UTSW 2 157040764 missense possibly damaging 0.91
R6304:Soga1 UTSW 2 157040764 missense possibly damaging 0.91
R6523:Soga1 UTSW 2 157060343 nonsense probably null
R7216:Soga1 UTSW 2 157018370 missense possibly damaging 0.76
R7335:Soga1 UTSW 2 157031005 missense possibly damaging 0.86
R7562:Soga1 UTSW 2 157053589 missense probably damaging 1.00
R7593:Soga1 UTSW 2 157040856 missense probably benign 0.40
R7788:Soga1 UTSW 2 157027584 missense probably benign 0.09
R8013:Soga1 UTSW 2 157030786 critical splice donor site probably null
R8263:Soga1 UTSW 2 157027590 missense possibly damaging 0.94
R8299:Soga1 UTSW 2 157020731 missense possibly damaging 0.93
X0019:Soga1 UTSW 2 157020264 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TAGCACTGAGAAACTGGTGG -3'
(R):5'- CTGGAGGTATGGCTGAGCATAG -3'

Sequencing Primer
(F):5'- TGGTGGGCCAGAATCCAAGC -3'
(R):5'- TGAGCATAGCCTTAGCGC -3'
Posted On2015-12-29