Incidental Mutation 'R4773:Ece1'
ID367657
Institutional Source Beutler Lab
Gene Symbol Ece1
Ensembl Gene ENSMUSG00000057530
Gene Nameendothelin converting enzyme 1
Synonyms
MMRRC Submission 042411-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R4773 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location137862237-137965229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137945153 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 369 (D369G)
Ref Sequence ENSEMBL: ENSMUSP00000099576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102518]
Predicted Effect probably benign
Transcript: ENSMUST00000102518
AA Change: D369G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099576
Gene: ENSMUSG00000057530
AA Change: D369G

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:Peptidase_M13_N 105 490 1.2e-112 PFAM
Pfam:Peptidase_M13 549 752 1.8e-77 PFAM
Meta Mutation Damage Score 0.2009 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations show cardiac and craniofacial abnormalities and embryonic mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,598 probably null Het
9230009I02Rik A G 11: 51,091,262 noncoding transcript Het
Actl7b T C 4: 56,740,972 I129V probably benign Het
Adipor2 A G 6: 119,359,086 L225P probably benign Het
Arhgap25 A G 6: 87,496,071 F35L probably benign Het
Asah2 A T 19: 32,052,858 M138K probably damaging Het
Asxl1 T A 2: 153,401,985 M1486K probably damaging Het
B4galt4 T A 16: 38,752,296 S114R probably benign Het
Brpf3 T G 17: 28,821,259 S885A probably benign Het
Cacna1g G T 11: 94,411,472 H1944N possibly damaging Het
Ccdc110 G A 8: 45,943,208 C712Y probably damaging Het
Ccdc175 A T 12: 72,136,048 I399N probably damaging Het
Cct8l1 A T 5: 25,517,756 T490S probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Copa A G 1: 172,105,220 N371D probably damaging Het
Cpeb1 A T 7: 81,355,947 H381Q probably benign Het
Cyp2d40 T A 15: 82,761,562 I81F possibly damaging Het
Dscc1 A T 15: 55,080,258 D405E probably benign Het
Exd2 T C 12: 80,475,818 V17A possibly damaging Het
Fam111a A T 19: 12,588,408 N507I possibly damaging Het
Flnc T C 6: 29,445,039 V719A possibly damaging Het
Fscb C T 12: 64,473,690 G334D probably damaging Het
Glud1 T C 14: 34,321,825 probably null Het
Gm8126 T A 14: 43,261,615 Y180* probably null Het
Grip2 G A 6: 91,782,432 P347L possibly damaging Het
H60b C T 10: 22,288,745 probably benign Het
Hist1h1d T C 13: 23,555,402 S105P probably damaging Het
Itga6 T C 2: 71,822,444 V217A probably benign Het
Kndc1 G A 7: 139,924,031 W1083* probably null Het
Limch1 A T 5: 67,027,507 D613V probably damaging Het
Lpl T A 8: 68,896,751 C310S probably damaging Het
March1 T A 8: 66,387,224 C220S probably benign Het
Mbd5 A C 2: 49,274,611 H308P probably damaging Het
Med13 T C 11: 86,276,920 D2003G probably damaging Het
Mettl16 T A 11: 74,817,301 V442D possibly damaging Het
Mstn A T 1: 53,062,108 T115S probably benign Het
Nfil3 A G 13: 52,968,014 S285P probably damaging Het
Olfr218 A C 1: 173,204,229 Y291S probably damaging Het
Olfr645 A G 7: 104,084,295 S262P probably damaging Het
Otof A G 5: 30,394,682 V321A probably benign Het
Pcdha8 G T 18: 36,994,573 A703S probably damaging Het
Pcdhb18 A G 18: 37,490,454 Y279C probably damaging Het
Pdgfa T C 5: 138,993,296 D51G probably benign Het
Pdzd8 A G 19: 59,300,860 Y703H probably damaging Het
Pecr G T 1: 72,267,435 P229Q probably damaging Het
Phkg1 G T 5: 129,873,273 probably null Het
Plxnb2 A T 15: 89,166,947 H356Q probably benign Het
Polr1b T C 2: 129,105,328 I191T probably benign Het
Ppp4r3a A G 12: 101,082,767 L35P possibly damaging Het
Rasa2 C T 9: 96,544,417 G792D probably benign Het
Rps11-ps4 T C 12: 51,297,623 noncoding transcript Het
Sema3g A G 14: 31,220,709 D89G probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slfn8 A G 11: 83,017,393 V108A probably damaging Het
Smg9 T A 7: 24,407,594 M221K possibly damaging Het
Soga1 G T 2: 157,030,569 Q953K probably benign Het
Sos1 A G 17: 80,398,231 S1304P probably damaging Het
Spert T A 14: 75,583,106 Y393F probably damaging Het
Sqle C A 15: 59,317,839 A110E possibly damaging Het
Stab2 G A 10: 86,907,371 Q1154* probably null Het
Taf4b A G 18: 14,804,520 T217A probably benign Het
Tex15 T C 8: 33,582,732 V2769A probably benign Het
Tmem156 A T 5: 65,080,159 C53S probably damaging Het
Tmtc3 T A 10: 100,457,139 K452N possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tph1 T C 7: 46,656,952 E195G probably damaging Het
Trpc6 T A 9: 8,609,851 Y107N possibly damaging Het
Tsga10 G A 1: 37,835,525 T93I probably damaging Het
Ttc25 C A 11: 100,549,916 N74K probably benign Het
Ttn T A 2: 76,741,434 N26372Y probably damaging Het
Tubd1 T C 11: 86,555,302 L256P possibly damaging Het
Txnrd2 C G 16: 18,440,819 A126G probably benign Het
Vmn1r210 T G 13: 22,827,204 K304T probably benign Het
Vps25 T C 11: 101,258,829 S160P probably benign Het
Vrk3 T A 7: 44,775,476 D438E probably benign Het
Vwa5b1 A G 4: 138,581,755 L708P probably benign Het
Washc3 C T 10: 88,219,262 Q105* probably null Het
Wdr83os T A 8: 85,080,781 probably benign Het
Wwc1 T C 11: 35,867,296 H741R probably benign Het
Zan T C 5: 137,436,313 probably benign Het
Zdhhc4 A T 5: 143,326,176 L14I possibly damaging Het
Zfp568 T A 7: 29,997,770 D38E probably damaging Het
Other mutations in Ece1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Ece1 APN 4 137938658 missense probably damaging 1.00
IGL01538:Ece1 APN 4 137948544 missense probably benign
IGL01588:Ece1 APN 4 137957206 splice site probably benign
IGL01678:Ece1 APN 4 137962733 missense probably damaging 1.00
IGL02619:Ece1 APN 4 137938733 missense probably benign 0.08
IGL02936:Ece1 APN 4 137946301 missense probably benign 0.01
IGL02956:Ece1 APN 4 137962838 missense probably damaging 0.99
IGL03332:Ece1 APN 4 137946355 missense probably damaging 0.99
R0063:Ece1 UTSW 4 137948581 missense probably benign 0.14
R0240:Ece1 UTSW 4 137949435 splice site probably benign
R1004:Ece1 UTSW 4 137926239 missense probably benign 0.04
R1515:Ece1 UTSW 4 137951508 missense probably benign 0.00
R1541:Ece1 UTSW 4 137948660 splice site probably null
R1796:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1834:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1834:Ece1 UTSW 4 137958128 missense probably damaging 0.99
R1836:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1930:Ece1 UTSW 4 137938763 missense probably benign 0.01
R1931:Ece1 UTSW 4 137938763 missense probably benign 0.01
R2065:Ece1 UTSW 4 137958082 missense probably benign 0.04
R2281:Ece1 UTSW 4 137946362 missense possibly damaging 0.93
R3118:Ece1 UTSW 4 137948544 missense probably benign
R4720:Ece1 UTSW 4 137957175 missense probably damaging 1.00
R5794:Ece1 UTSW 4 137956533 missense probably damaging 0.99
R5969:Ece1 UTSW 4 137961740 critical splice donor site probably null
R6056:Ece1 UTSW 4 137961647 missense probably damaging 1.00
R6332:Ece1 UTSW 4 137958008 missense probably damaging 1.00
R6648:Ece1 UTSW 4 137921159 missense probably benign 0.00
R7285:Ece1 UTSW 4 137913763 splice site probably null
R7387:Ece1 UTSW 4 137938784 missense possibly damaging 0.69
R8103:Ece1 UTSW 4 137913822 missense probably benign
R8294:Ece1 UTSW 4 137948620 missense possibly damaging 0.60
R8308:Ece1 UTSW 4 137936764 missense probably damaging 0.99
R8806:Ece1 UTSW 4 137945141 missense probably damaging 1.00
X0063:Ece1 UTSW 4 137926375 missense probably damaging 0.97
Z1176:Ece1 UTSW 4 137921027 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AAAGCCTTCTGAGGAATGGC -3'
(R):5'- GCCAGGACTTCCTTCTCGTAAC -3'

Sequencing Primer
(F):5'- CTTCTGAGGAATGGCCGGAGAC -3'
(R):5'- ACAGCCTCTCCGTATGGTG -3'
Posted On2015-12-29