Incidental Mutation 'R4773:Tmem156'
ID367662
Institutional Source Beutler Lab
Gene Symbol Tmem156
Ensembl Gene ENSMUSG00000037913
Gene Nametransmembrane protein 156
SynonymsLOC243025
MMRRC Submission 042411-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4773 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location65054346-65092132 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65080159 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 53 (C53S)
Ref Sequence ENSEMBL: ENSMUSP00000148480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043352] [ENSMUST00000212080] [ENSMUST00000212194] [ENSMUST00000212640]
Predicted Effect probably damaging
Transcript: ENSMUST00000043352
AA Change: C41S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044102
Gene: ENSMUSG00000037913
AA Change: C41S

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:TMEM156 39 264 1.2e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203664
Predicted Effect probably damaging
Transcript: ENSMUST00000212080
AA Change: C53S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000212194
Predicted Effect probably benign
Transcript: ENSMUST00000212640
Meta Mutation Damage Score 0.5813 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (89/89)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,598 probably null Het
9230009I02Rik A G 11: 51,091,262 noncoding transcript Het
Actl7b T C 4: 56,740,972 I129V probably benign Het
Adipor2 A G 6: 119,359,086 L225P probably benign Het
Arhgap25 A G 6: 87,496,071 F35L probably benign Het
Asah2 A T 19: 32,052,858 M138K probably damaging Het
Asxl1 T A 2: 153,401,985 M1486K probably damaging Het
B4galt4 T A 16: 38,752,296 S114R probably benign Het
Brpf3 T G 17: 28,821,259 S885A probably benign Het
Cacna1g G T 11: 94,411,472 H1944N possibly damaging Het
Ccdc110 G A 8: 45,943,208 C712Y probably damaging Het
Ccdc175 A T 12: 72,136,048 I399N probably damaging Het
Cct8l1 A T 5: 25,517,756 T490S probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Copa A G 1: 172,105,220 N371D probably damaging Het
Cpeb1 A T 7: 81,355,947 H381Q probably benign Het
Cyp2d40 T A 15: 82,761,562 I81F possibly damaging Het
Dscc1 A T 15: 55,080,258 D405E probably benign Het
Ece1 A G 4: 137,945,153 D369G probably benign Het
Exd2 T C 12: 80,475,818 V17A possibly damaging Het
Fam111a A T 19: 12,588,408 N507I possibly damaging Het
Flnc T C 6: 29,445,039 V719A possibly damaging Het
Fscb C T 12: 64,473,690 G334D probably damaging Het
Glud1 T C 14: 34,321,825 probably null Het
Gm8126 T A 14: 43,261,615 Y180* probably null Het
Grip2 G A 6: 91,782,432 P347L possibly damaging Het
H60b C T 10: 22,288,745 probably benign Het
Hist1h1d T C 13: 23,555,402 S105P probably damaging Het
Itga6 T C 2: 71,822,444 V217A probably benign Het
Kndc1 G A 7: 139,924,031 W1083* probably null Het
Limch1 A T 5: 67,027,507 D613V probably damaging Het
Lpl T A 8: 68,896,751 C310S probably damaging Het
March1 T A 8: 66,387,224 C220S probably benign Het
Mbd5 A C 2: 49,274,611 H308P probably damaging Het
Med13 T C 11: 86,276,920 D2003G probably damaging Het
Mettl16 T A 11: 74,817,301 V442D possibly damaging Het
Mstn A T 1: 53,062,108 T115S probably benign Het
Nfil3 A G 13: 52,968,014 S285P probably damaging Het
Olfr218 A C 1: 173,204,229 Y291S probably damaging Het
Olfr645 A G 7: 104,084,295 S262P probably damaging Het
Otof A G 5: 30,394,682 V321A probably benign Het
Pcdha8 G T 18: 36,994,573 A703S probably damaging Het
Pcdhb18 A G 18: 37,490,454 Y279C probably damaging Het
Pdgfa T C 5: 138,993,296 D51G probably benign Het
Pdzd8 A G 19: 59,300,860 Y703H probably damaging Het
Pecr G T 1: 72,267,435 P229Q probably damaging Het
Phkg1 G T 5: 129,873,273 probably null Het
Plxnb2 A T 15: 89,166,947 H356Q probably benign Het
Polr1b T C 2: 129,105,328 I191T probably benign Het
Ppp4r3a A G 12: 101,082,767 L35P possibly damaging Het
Rasa2 C T 9: 96,544,417 G792D probably benign Het
Rps11-ps4 T C 12: 51,297,623 noncoding transcript Het
Sema3g A G 14: 31,220,709 D89G probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slfn8 A G 11: 83,017,393 V108A probably damaging Het
Smg9 T A 7: 24,407,594 M221K possibly damaging Het
Soga1 G T 2: 157,030,569 Q953K probably benign Het
Sos1 A G 17: 80,398,231 S1304P probably damaging Het
Spert T A 14: 75,583,106 Y393F probably damaging Het
Sqle C A 15: 59,317,839 A110E possibly damaging Het
Stab2 G A 10: 86,907,371 Q1154* probably null Het
Taf4b A G 18: 14,804,520 T217A probably benign Het
Tex15 T C 8: 33,582,732 V2769A probably benign Het
Tmtc3 T A 10: 100,457,139 K452N possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tph1 T C 7: 46,656,952 E195G probably damaging Het
Trpc6 T A 9: 8,609,851 Y107N possibly damaging Het
Tsga10 G A 1: 37,835,525 T93I probably damaging Het
Ttc25 C A 11: 100,549,916 N74K probably benign Het
Ttn T A 2: 76,741,434 N26372Y probably damaging Het
Tubd1 T C 11: 86,555,302 L256P possibly damaging Het
Txnrd2 C G 16: 18,440,819 A126G probably benign Het
Vmn1r210 T G 13: 22,827,204 K304T probably benign Het
Vps25 T C 11: 101,258,829 S160P probably benign Het
Vrk3 T A 7: 44,775,476 D438E probably benign Het
Vwa5b1 A G 4: 138,581,755 L708P probably benign Het
Washc3 C T 10: 88,219,262 Q105* probably null Het
Wdr83os T A 8: 85,080,781 probably benign Het
Wwc1 T C 11: 35,867,296 H741R probably benign Het
Zan T C 5: 137,436,313 probably benign Het
Zdhhc4 A T 5: 143,326,176 L14I possibly damaging Het
Zfp568 T A 7: 29,997,770 D38E probably damaging Het
Other mutations in Tmem156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Tmem156 APN 5 65073840 missense probably damaging 1.00
IGL01064:Tmem156 APN 5 65079984 missense probably damaging 0.99
IGL01330:Tmem156 APN 5 65080182 missense probably benign 0.17
IGL03336:Tmem156 APN 5 65075764 missense probably benign 0.01
IGL03383:Tmem156 APN 5 65075697 missense probably damaging 0.98
R0526:Tmem156 UTSW 5 65075818 missense probably benign 0.02
R2006:Tmem156 UTSW 5 65079951 missense probably damaging 1.00
R4721:Tmem156 UTSW 5 65091527 missense probably benign 0.10
R4810:Tmem156 UTSW 5 65091447 intron probably benign
R4910:Tmem156 UTSW 5 65091462 intron probably benign
R5148:Tmem156 UTSW 5 65073768 missense probably benign 0.00
R5510:Tmem156 UTSW 5 65075574 missense probably benign 0.02
R5809:Tmem156 UTSW 5 65075607 missense possibly damaging 0.55
R6033:Tmem156 UTSW 5 65075621 missense probably benign 0.35
R6033:Tmem156 UTSW 5 65075621 missense probably benign 0.35
R7731:Tmem156 UTSW 5 65075562 critical splice donor site probably null
R7772:Tmem156 UTSW 5 65080174 missense probably damaging 1.00
R7788:Tmem156 UTSW 5 65075569 missense possibly damaging 0.47
R7979:Tmem156 UTSW 5 65080009 missense possibly damaging 0.47
R8017:Tmem156 UTSW 5 65073861 missense probably damaging 1.00
R8132:Tmem156 UTSW 5 65075755 missense probably benign 0.00
R8249:Tmem156 UTSW 5 65075626 nonsense probably null
RF020:Tmem156 UTSW 5 65091547 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AACACATCGGCAATCTACTTGTG -3'
(R):5'- GTTCTCTGAAAACTAACACGGAATG -3'

Sequencing Primer
(F):5'- ATCGGCAATCTACTTGTGATGCC -3'
(R):5'- TCAAGGACTAGCCATCCT -3'
Posted On2015-12-29