Incidental Mutation 'R4773:Stab2'
ID367689
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Namestabilin 2
SynonymsSTAB-2, FEEL-2
MMRRC Submission 042411-MU
Accession Numbers

Genbank: NM_138673; MGI: 2178743

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4773 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location86841198-87008025 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 86907371 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1154 (Q1154*)
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
Predicted Effect probably null
Transcript: ENSMUST00000035288
AA Change: Q1154*
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: Q1154*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162458
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,598 probably null Het
9230009I02Rik A G 11: 51,091,262 noncoding transcript Het
Actl7b T C 4: 56,740,972 I129V probably benign Het
Adipor2 A G 6: 119,359,086 L225P probably benign Het
Arhgap25 A G 6: 87,496,071 F35L probably benign Het
Asah2 A T 19: 32,052,858 M138K probably damaging Het
Asxl1 T A 2: 153,401,985 M1486K probably damaging Het
B4galt4 T A 16: 38,752,296 S114R probably benign Het
Brpf3 T G 17: 28,821,259 S885A probably benign Het
Cacna1g G T 11: 94,411,472 H1944N possibly damaging Het
Ccdc110 G A 8: 45,943,208 C712Y probably damaging Het
Ccdc175 A T 12: 72,136,048 I399N probably damaging Het
Cct8l1 A T 5: 25,517,756 T490S probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Copa A G 1: 172,105,220 N371D probably damaging Het
Cpeb1 A T 7: 81,355,947 H381Q probably benign Het
Cyp2d40 T A 15: 82,761,562 I81F possibly damaging Het
Dscc1 A T 15: 55,080,258 D405E probably benign Het
Ece1 A G 4: 137,945,153 D369G probably benign Het
Exd2 T C 12: 80,475,818 V17A possibly damaging Het
Fam111a A T 19: 12,588,408 N507I possibly damaging Het
Flnc T C 6: 29,445,039 V719A possibly damaging Het
Fscb C T 12: 64,473,690 G334D probably damaging Het
Glud1 T C 14: 34,321,825 probably null Het
Gm8126 T A 14: 43,261,615 Y180* probably null Het
Grip2 G A 6: 91,782,432 P347L possibly damaging Het
H60b C T 10: 22,288,745 probably benign Het
Hist1h1d T C 13: 23,555,402 S105P probably damaging Het
Itga6 T C 2: 71,822,444 V217A probably benign Het
Kndc1 G A 7: 139,924,031 W1083* probably null Het
Limch1 A T 5: 67,027,507 D613V probably damaging Het
Lpl T A 8: 68,896,751 C310S probably damaging Het
March1 T A 8: 66,387,224 C220S probably benign Het
Mbd5 A C 2: 49,274,611 H308P probably damaging Het
Med13 T C 11: 86,276,920 D2003G probably damaging Het
Mettl16 T A 11: 74,817,301 V442D possibly damaging Het
Mstn A T 1: 53,062,108 T115S probably benign Het
Nfil3 A G 13: 52,968,014 S285P probably damaging Het
Olfr218 A C 1: 173,204,229 Y291S probably damaging Het
Olfr645 A G 7: 104,084,295 S262P probably damaging Het
Otof A G 5: 30,394,682 V321A probably benign Het
Pcdha8 G T 18: 36,994,573 A703S probably damaging Het
Pcdhb18 A G 18: 37,490,454 Y279C probably damaging Het
Pdgfa T C 5: 138,993,296 D51G probably benign Het
Pdzd8 A G 19: 59,300,860 Y703H probably damaging Het
Pecr G T 1: 72,267,435 P229Q probably damaging Het
Phkg1 G T 5: 129,873,273 probably null Het
Plxnb2 A T 15: 89,166,947 H356Q probably benign Het
Polr1b T C 2: 129,105,328 I191T probably benign Het
Ppp4r3a A G 12: 101,082,767 L35P possibly damaging Het
Rasa2 C T 9: 96,544,417 G792D probably benign Het
Rps11-ps4 T C 12: 51,297,623 noncoding transcript Het
Sema3g A G 14: 31,220,709 D89G probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slfn8 A G 11: 83,017,393 V108A probably damaging Het
Smg9 T A 7: 24,407,594 M221K possibly damaging Het
Soga1 G T 2: 157,030,569 Q953K probably benign Het
Sos1 A G 17: 80,398,231 S1304P probably damaging Het
Spert T A 14: 75,583,106 Y393F probably damaging Het
Sqle C A 15: 59,317,839 A110E possibly damaging Het
Taf4b A G 18: 14,804,520 T217A probably benign Het
Tex15 T C 8: 33,582,732 V2769A probably benign Het
Tmem156 A T 5: 65,080,159 C53S probably damaging Het
Tmtc3 T A 10: 100,457,139 K452N possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tph1 T C 7: 46,656,952 E195G probably damaging Het
Trpc6 T A 9: 8,609,851 Y107N possibly damaging Het
Tsga10 G A 1: 37,835,525 T93I probably damaging Het
Ttc25 C A 11: 100,549,916 N74K probably benign Het
Ttn T A 2: 76,741,434 N26372Y probably damaging Het
Tubd1 T C 11: 86,555,302 L256P possibly damaging Het
Txnrd2 C G 16: 18,440,819 A126G probably benign Het
Vmn1r210 T G 13: 22,827,204 K304T probably benign Het
Vps25 T C 11: 101,258,829 S160P probably benign Het
Vrk3 T A 7: 44,775,476 D438E probably benign Het
Vwa5b1 A G 4: 138,581,755 L708P probably benign Het
Washc3 C T 10: 88,219,262 Q105* probably null Het
Wdr83os T A 8: 85,080,781 probably benign Het
Wwc1 T C 11: 35,867,296 H741R probably benign Het
Zan T C 5: 137,436,313 probably benign Het
Zdhhc4 A T 5: 143,326,176 L14I possibly damaging Het
Zfp568 T A 7: 29,997,770 D38E probably damaging Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86869206 unclassified probably null
IGL00809:Stab2 APN 10 86848174 splice site probably benign
IGL00911:Stab2 APN 10 86969753 missense probably damaging 1.00
IGL01347:Stab2 APN 10 86901703 splice site probably null
IGL01411:Stab2 APN 10 86980008 splice site probably benign
IGL01503:Stab2 APN 10 86940613 splice site probably benign
IGL01599:Stab2 APN 10 86922895 missense probably damaging 1.00
IGL01635:Stab2 APN 10 86981128 missense probably benign 0.04
IGL01640:Stab2 APN 10 86954171 missense probably benign 0.09
IGL01671:Stab2 APN 10 86969277 missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86871831 missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86967650 missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86859742 unclassified probably null
IGL02600:Stab2 APN 10 86954259 missense probably damaging 1.00
IGL02666:Stab2 APN 10 86850902 missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86846163 splice site probably benign
IGL02709:Stab2 APN 10 86846165 splice site probably benign
IGL02728:Stab2 APN 10 86856556 missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86950269 splice site probably benign
IGL02938:Stab2 APN 10 86871921 missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86996803 critical splice donor site probably null
IGL03238:Stab2 APN 10 86855121 missense probably damaging 1.00
IGL03402:Stab2 APN 10 86969301 missense probably benign 0.03
3-1:Stab2 UTSW 10 86869177 missense probably damaging 0.96
F6893:Stab2 UTSW 10 86855171 missense probably damaging 1.00
K7371:Stab2 UTSW 10 86943289 critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86867175 missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86861435 nonsense probably null
R0015:Stab2 UTSW 10 86843617 missense probably benign
R0254:Stab2 UTSW 10 86897960 missense probably benign
R0310:Stab2 UTSW 10 86967613 splice site probably benign
R0333:Stab2 UTSW 10 86841627 missense probably benign
R0391:Stab2 UTSW 10 86947144 missense probably benign 0.27
R0400:Stab2 UTSW 10 86872610 missense probably damaging 1.00
R0433:Stab2 UTSW 10 86843491 splice site probably benign
R0440:Stab2 UTSW 10 86949928 missense probably benign 0.23
R0743:Stab2 UTSW 10 86887895 missense probably damaging 1.00
R0847:Stab2 UTSW 10 86969871 missense probably benign 0.00
R0883:Stab2 UTSW 10 86924450 splice site probably benign
R1078:Stab2 UTSW 10 86907133 splice site probably null
R1118:Stab2 UTSW 10 86885718 unclassified probably null
R1119:Stab2 UTSW 10 86859755 missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86950301 missense probably damaging 0.98
R1440:Stab2 UTSW 10 86861367 unclassified probably null
R1550:Stab2 UTSW 10 86878926 missense probably benign 0.01
R1616:Stab2 UTSW 10 86885718 unclassified probably null
R1728:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1768:Stab2 UTSW 10 87003008 missense probably damaging 1.00
R1772:Stab2 UTSW 10 86954234 missense probably benign 0.06
R1776:Stab2 UTSW 10 86957816 missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1892:Stab2 UTSW 10 86938049 missense probably damaging 0.99
R1957:Stab2 UTSW 10 86861470 missense probably benign 0.13
R1972:Stab2 UTSW 10 86960316 missense probably damaging 0.99
R1975:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1976:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1996:Stab2 UTSW 10 87003031 missense probably damaging 1.00
R2085:Stab2 UTSW 10 86954159 missense probably damaging 1.00
R2149:Stab2 UTSW 10 86865040 nonsense probably null
R2169:Stab2 UTSW 10 86887862 missense probably damaging 1.00
R2201:Stab2 UTSW 10 86940639 missense probably benign 0.22
R2296:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86969319 missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86934840 splice site probably benign
R2696:Stab2 UTSW 10 86861499 missense probably benign 0.45
R2883:Stab2 UTSW 10 86967686 missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86861461 missense probably damaging 1.00
R3711:Stab2 UTSW 10 86866708 missense probably damaging 1.00
R3787:Stab2 UTSW 10 86969277 missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86949912 missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86878886 missense probably damaging 0.97
R3979:Stab2 UTSW 10 86863456 missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86858124 missense probably damaging 1.00
R4088:Stab2 UTSW 10 86922185 missense probably damaging 1.00
R4151:Stab2 UTSW 10 87002983 missense probably benign 0.12
R4190:Stab2 UTSW 10 86878944 missense probably damaging 0.98
R4556:Stab2 UTSW 10 86967679 missense possibly damaging 0.95
R4825:Stab2 UTSW 10 86947147 missense probably benign 0.08
R4865:Stab2 UTSW 10 86843500 unclassified probably null
R4871:Stab2 UTSW 10 86942235 missense probably damaging 0.99
R4943:Stab2 UTSW 10 86954162 missense probably damaging 0.99
R4981:Stab2 UTSW 10 86960223 missense probably benign
R4994:Stab2 UTSW 10 86949907 missense probably benign
R4999:Stab2 UTSW 10 86937909 missense probably damaging 0.97
R5061:Stab2 UTSW 10 86907385 missense probably damaging 1.00
R5072:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5073:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5074:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5134:Stab2 UTSW 10 86871810 unclassified probably null
R5213:Stab2 UTSW 10 86907197 missense probably damaging 0.99
R5508:Stab2 UTSW 10 86960279 missense probably benign 0.01
R5530:Stab2 UTSW 10 86947162 missense probably benign 0.04
R5540:Stab2 UTSW 10 86848125 missense probably benign 0.30
R5839:Stab2 UTSW 10 86872691 missense probably damaging 0.97
R5949:Stab2 UTSW 10 86969849 missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86938042 missense probably damaging 0.99
R6019:Stab2 UTSW 10 87003022 missense probably benign 0.00
R6116:Stab2 UTSW 10 86907190 missense probably damaging 1.00
R6131:Stab2 UTSW 10 86883778 unclassified probably null
R6209:Stab2 UTSW 10 86923003 missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86907161 missense probably damaging 1.00
R6433:Stab2 UTSW 10 86901567 splice site probably null
R6787:Stab2 UTSW 10 86919084 missense probably benign 0.07
R6841:Stab2 UTSW 10 86942190 missense probably damaging 1.00
R6873:Stab2 UTSW 10 86861366 critical splice donor site probably null
R7025:Stab2 UTSW 10 86850837 missense probably damaging 1.00
R7043:Stab2 UTSW 10 86870246 missense probably damaging 0.99
R7047:Stab2 UTSW 10 86858152 missense probably damaging 1.00
R7107:Stab2 UTSW 10 86905592 missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86899841 missense probably damaging 0.99
R7271:Stab2 UTSW 10 87003108 splice site probably null
R7291:Stab2 UTSW 10 86946220 missense probably damaging 0.96
R7336:Stab2 UTSW 10 86969185 nonsense probably null
R7432:Stab2 UTSW 10 86885683 missense probably damaging 0.99
R7580:Stab2 UTSW 10 86869164 missense probably benign 0.00
R7622:Stab2 UTSW 10 86873902 missense possibly damaging 0.65
R7629:Stab2 UTSW 10 86883782 critical splice donor site probably null
R7658:Stab2 UTSW 10 86981135 missense probably benign 0.12
X0023:Stab2 UTSW 10 86922198 critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86887816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAAATACAGTATAAGCATCTGC -3'
(R):5'- TTCCAGACTTTGCATCCTGG -3'

Sequencing Primer
(F):5'- GTATAAGCATCTGCAGCCTCGATTG -3'
(R):5'- TCCAGACTTTGCATCCTGGAATAAC -3'
Posted On2015-12-29