Incidental Mutation 'R4773:Asah2'
ID 367727
Institutional Source Beutler Lab
Gene Symbol Asah2
Ensembl Gene ENSMUSG00000024887
Gene Name N-acylsphingosine amidohydrolase 2
Synonyms neutral/alkaline ceramidase
MMRRC Submission 042411-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.448) question?
Stock # R4773 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 31962046-32080540 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32030258 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 138 (M138K)
Ref Sequence ENSEMBL: ENSMUSP00000093830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096119]
AlphaFold Q9JHE3
Predicted Effect probably damaging
Transcript: ENSMUST00000096119
AA Change: M138K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093830
Gene: ENSMUSG00000024887
AA Change: M138K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
Pfam:Ceramidase_alk 78 584 1.4e-222 PFAM
Pfam:Ceramidse_alk_C 586 753 8e-50 PFAM
Meta Mutation Damage Score 0.8828 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are defective in the intestinal digestion of dietary ceramide but exhibit a normal life span with no obvious abnormalities or significant alterations in total ceramide levels in major organ tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230009I02Rik A G 11: 50,982,089 (GRCm39) noncoding transcript Het
Actl7b T C 4: 56,740,972 (GRCm39) I129V probably benign Het
Adipor2 A G 6: 119,336,047 (GRCm39) L225P probably benign Het
Arhgap25 A G 6: 87,473,053 (GRCm39) F35L probably benign Het
Asxl1 T A 2: 153,243,905 (GRCm39) M1486K probably damaging Het
B4galt4 T A 16: 38,572,658 (GRCm39) S114R probably benign Het
Brpf3 T G 17: 29,040,233 (GRCm39) S885A probably benign Het
Cacna1g G T 11: 94,302,298 (GRCm39) H1944N possibly damaging Het
Cby2 T A 14: 75,820,546 (GRCm39) Y393F probably damaging Het
Ccdc110 G A 8: 46,396,245 (GRCm39) C712Y probably damaging Het
Ccdc175 A T 12: 72,182,822 (GRCm39) I399N probably damaging Het
Cct8l1 A T 5: 25,722,754 (GRCm39) T490S probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Copa A G 1: 171,932,787 (GRCm39) N371D probably damaging Het
Cpeb1 A T 7: 81,005,695 (GRCm39) H381Q probably benign Het
Cyp2d40 T A 15: 82,645,763 (GRCm39) I81F possibly damaging Het
Dscc1 A T 15: 54,943,654 (GRCm39) D405E probably benign Het
Ece1 A G 4: 137,672,464 (GRCm39) D369G probably benign Het
Exd2 T C 12: 80,522,592 (GRCm39) V17A possibly damaging Het
Fam111a A T 19: 12,565,772 (GRCm39) N507I possibly damaging Het
Flnc T C 6: 29,445,038 (GRCm39) V719A possibly damaging Het
Fscb C T 12: 64,520,464 (GRCm39) G334D probably damaging Het
Glud1 T C 14: 34,043,782 (GRCm39) probably null Het
Gm8126 T A 14: 43,119,072 (GRCm39) Y180* probably null Het
Grip2 G A 6: 91,759,413 (GRCm39) P347L possibly damaging Het
H1f3 T C 13: 23,739,576 (GRCm39) S105P probably damaging Het
H60b C T 10: 22,164,644 (GRCm39) probably benign Het
Iqca1l A G 5: 24,755,596 (GRCm39) probably null Het
Itga6 T C 2: 71,652,788 (GRCm39) V217A probably benign Het
Kndc1 G A 7: 139,503,946 (GRCm39) W1083* probably null Het
Limch1 A T 5: 67,184,850 (GRCm39) D613V probably damaging Het
Lpl T A 8: 69,349,403 (GRCm39) C310S probably damaging Het
Marchf1 T A 8: 66,839,876 (GRCm39) C220S probably benign Het
Mbd5 A C 2: 49,164,623 (GRCm39) H308P probably damaging Het
Med13 T C 11: 86,167,746 (GRCm39) D2003G probably damaging Het
Mettl16 T A 11: 74,708,127 (GRCm39) V442D possibly damaging Het
Mstn A T 1: 53,101,267 (GRCm39) T115S probably benign Het
Mtcl2 G T 2: 156,872,489 (GRCm39) Q953K probably benign Het
Nfil3 A G 13: 53,122,050 (GRCm39) S285P probably damaging Het
Odad4 C A 11: 100,440,742 (GRCm39) N74K probably benign Het
Or10j3 A C 1: 173,031,796 (GRCm39) Y291S probably damaging Het
Or51a24 A G 7: 103,733,502 (GRCm39) S262P probably damaging Het
Otof A G 5: 30,552,026 (GRCm39) V321A probably benign Het
Pcdha8 G T 18: 37,127,626 (GRCm39) A703S probably damaging Het
Pcdhb18 A G 18: 37,623,507 (GRCm39) Y279C probably damaging Het
Pdgfa T C 5: 138,979,051 (GRCm39) D51G probably benign Het
Pdzd8 A G 19: 59,289,292 (GRCm39) Y703H probably damaging Het
Pecr G T 1: 72,306,594 (GRCm39) P229Q probably damaging Het
Phkg1 G T 5: 129,902,114 (GRCm39) probably null Het
Plxnb2 A T 15: 89,051,150 (GRCm39) H356Q probably benign Het
Polr1b T C 2: 128,947,248 (GRCm39) I191T probably benign Het
Ppp4r3a A G 12: 101,049,026 (GRCm39) L35P possibly damaging Het
Rasa2 C T 9: 96,426,470 (GRCm39) G792D probably benign Het
Rps11-ps4 T C 12: 51,344,406 (GRCm39) noncoding transcript Het
Sema3g A G 14: 30,942,666 (GRCm39) D89G probably benign Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slfn8 A G 11: 82,908,219 (GRCm39) V108A probably damaging Het
Smg9 T A 7: 24,107,019 (GRCm39) M221K possibly damaging Het
Sos1 A G 17: 80,705,660 (GRCm39) S1304P probably damaging Het
Sqle C A 15: 59,189,688 (GRCm39) A110E possibly damaging Het
Stab2 G A 10: 86,743,235 (GRCm39) Q1154* probably null Het
Taf4b A G 18: 14,937,577 (GRCm39) T217A probably benign Het
Tex15 T C 8: 34,072,760 (GRCm39) V2769A probably benign Het
Tmem156 A T 5: 65,237,502 (GRCm39) C53S probably damaging Het
Tmtc3 T A 10: 100,293,001 (GRCm39) K452N possibly damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tph1 T C 7: 46,306,376 (GRCm39) E195G probably damaging Het
Trpc6 T A 9: 8,609,852 (GRCm39) Y107N possibly damaging Het
Tsga10 G A 1: 37,874,606 (GRCm39) T93I probably damaging Het
Ttn T A 2: 76,571,778 (GRCm39) N26372Y probably damaging Het
Tubd1 T C 11: 86,446,128 (GRCm39) L256P possibly damaging Het
Txnrd2 C G 16: 18,259,569 (GRCm39) A126G probably benign Het
Vmn1r210 T G 13: 23,011,374 (GRCm39) K304T probably benign Het
Vps25 T C 11: 101,149,655 (GRCm39) S160P probably benign Het
Vrk3 T A 7: 44,424,900 (GRCm39) D438E probably benign Het
Vwa5b1 A G 4: 138,309,066 (GRCm39) L708P probably benign Het
Washc3 C T 10: 88,055,124 (GRCm39) Q105* probably null Het
Wdr83os T A 8: 85,807,410 (GRCm39) probably benign Het
Wwc1 T C 11: 35,758,123 (GRCm39) H741R probably benign Het
Zan T C 5: 137,434,575 (GRCm39) probably benign Het
Zdhhc4 A T 5: 143,311,931 (GRCm39) L14I possibly damaging Het
Zfp568 T A 7: 29,697,195 (GRCm39) D38E probably damaging Het
Other mutations in Asah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Asah2 APN 19 31,986,081 (GRCm39) splice site probably benign
IGL02001:Asah2 APN 19 32,020,939 (GRCm39) nonsense probably null
IGL02228:Asah2 APN 19 31,994,114 (GRCm39) missense probably benign 0.09
IGL02377:Asah2 APN 19 31,986,814 (GRCm39) missense probably benign 0.30
IGL03070:Asah2 APN 19 31,983,744 (GRCm39) missense probably damaging 1.00
IGL03233:Asah2 APN 19 32,032,031 (GRCm39) missense probably benign 0.18
IGL03244:Asah2 APN 19 31,964,342 (GRCm39) missense probably damaging 1.00
R0008:Asah2 UTSW 19 31,981,131 (GRCm39) nonsense probably null
R0103:Asah2 UTSW 19 31,996,377 (GRCm39) missense probably benign 0.01
R0103:Asah2 UTSW 19 31,996,377 (GRCm39) missense probably benign 0.01
R0302:Asah2 UTSW 19 32,030,356 (GRCm39) missense probably benign 0.01
R0497:Asah2 UTSW 19 32,032,031 (GRCm39) missense probably benign 0.18
R0614:Asah2 UTSW 19 31,994,128 (GRCm39) missense probably damaging 1.00
R0639:Asah2 UTSW 19 31,986,039 (GRCm39) missense probably damaging 0.99
R0715:Asah2 UTSW 19 31,994,176 (GRCm39) missense probably damaging 0.97
R1332:Asah2 UTSW 19 32,022,341 (GRCm39) missense probably damaging 1.00
R1336:Asah2 UTSW 19 32,022,341 (GRCm39) missense probably damaging 1.00
R2045:Asah2 UTSW 19 32,030,356 (GRCm39) missense probably benign 0.01
R2062:Asah2 UTSW 19 32,002,274 (GRCm39) missense probably damaging 0.99
R4083:Asah2 UTSW 19 31,964,184 (GRCm39) missense probably benign 0.01
R4698:Asah2 UTSW 19 32,031,871 (GRCm39) splice site probably null
R4731:Asah2 UTSW 19 31,972,758 (GRCm39) missense probably benign 0.41
R4732:Asah2 UTSW 19 31,972,758 (GRCm39) missense probably benign 0.41
R4733:Asah2 UTSW 19 31,972,758 (GRCm39) missense probably benign 0.41
R4930:Asah2 UTSW 19 32,030,306 (GRCm39) missense probably benign 0.35
R5081:Asah2 UTSW 19 31,991,708 (GRCm39) missense probably benign 0.07
R5741:Asah2 UTSW 19 31,986,015 (GRCm39) missense probably damaging 1.00
R5873:Asah2 UTSW 19 31,981,082 (GRCm39) critical splice donor site probably null
R5905:Asah2 UTSW 19 31,993,914 (GRCm39) missense probably damaging 1.00
R6027:Asah2 UTSW 19 32,022,351 (GRCm39) missense probably benign 0.01
R6028:Asah2 UTSW 19 31,993,914 (GRCm39) missense probably damaging 1.00
R6187:Asah2 UTSW 19 32,002,267 (GRCm39) missense probably damaging 0.99
R6667:Asah2 UTSW 19 31,972,758 (GRCm39) missense probably benign 0.41
R6968:Asah2 UTSW 19 31,989,913 (GRCm39) missense probably benign
R7010:Asah2 UTSW 19 32,031,954 (GRCm39) missense probably benign 0.00
R7404:Asah2 UTSW 19 32,035,254 (GRCm39) missense probably benign 0.13
R7575:Asah2 UTSW 19 31,994,103 (GRCm39) missense probably benign 0.11
R7797:Asah2 UTSW 19 31,999,761 (GRCm39) missense probably damaging 1.00
R8492:Asah2 UTSW 19 31,983,659 (GRCm39) missense probably benign 0.25
R8682:Asah2 UTSW 19 32,030,277 (GRCm39) missense probably damaging 1.00
R8766:Asah2 UTSW 19 32,035,280 (GRCm39) missense possibly damaging 0.46
R8873:Asah2 UTSW 19 32,022,288 (GRCm39) critical splice donor site probably null
R8974:Asah2 UTSW 19 32,030,305 (GRCm39) missense probably benign
R9088:Asah2 UTSW 19 32,030,360 (GRCm39) missense probably damaging 1.00
R9405:Asah2 UTSW 19 31,986,045 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACTCATAACGATGACGAGTCG -3'
(R):5'- CTCTTCTGATAGGATGGTGCC -3'

Sequencing Primer
(F):5'- AGGAAGGGCATCCACCTATGTATC -3'
(R):5'- TGCCTGGCTCCTGAAGAAGTTC -3'
Posted On 2015-12-29