Incidental Mutation 'R4774:Tsen2'
ID367754
Institutional Source Beutler Lab
Gene Symbol Tsen2
Ensembl Gene ENSMUSG00000042389
Gene NametRNA splicing endonuclease subunit 2
Synonyms
MMRRC Submission 042412-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R4774 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location115544664-115578628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115575933 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 398 (S398L)
Ref Sequence ENSEMBL: ENSMUSP00000038211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040234]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040234
AA Change: S398L

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038211
Gene: ENSMUSG00000042389
AA Change: S398L

DomainStartEndE-ValueType
Blast:HOLI 1 55 2e-23 BLAST
Pfam:tRNA_int_endo_N 258 324 9.9e-16 PFAM
Pfam:tRNA_int_endo 334 426 5.2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143520
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the tRNA splicing endonuclease. This endonuclease catalyzes the first step in RNA splicing which is the removal of introns. Mutations in this gene have been associated with pontocerebellar hypoplasia type 2. A pseudogene has been identified on chromosome 4. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,317 I844V probably damaging Het
Acnat1 T A 4: 49,450,784 Y109F probably benign Het
Alox12b T C 11: 69,163,207 V205A probably benign Het
Apopt1 A G 12: 111,713,389 T33A possibly damaging Het
Arl6ip1 G A 7: 118,121,985 R77C probably damaging Het
Atp8b1 A G 18: 64,533,659 C1156R possibly damaging Het
Atp8b3 A C 10: 80,536,322 N24K probably damaging Het
Bdh1 T C 16: 31,455,136 V209A possibly damaging Het
Blm A T 7: 80,463,848 C1234S probably damaging Het
Caml A G 13: 55,631,927 D271G possibly damaging Het
Capn11 T C 17: 45,633,080 D545G probably benign Het
Catspere1 T C 1: 177,937,738 noncoding transcript Het
Ccdc114 T A 7: 45,948,380 S571R probably damaging Het
Cep128 T C 12: 91,234,195 E347G probably damaging Het
Cngb3 A G 4: 19,415,713 T408A possibly damaging Het
Cog1 G A 11: 113,657,427 R18Q possibly damaging Het
Cps1 T C 1: 67,220,512 F1338L probably damaging Het
Csmd1 T C 8: 16,009,369 H2122R probably benign Het
Ctu2 T G 8: 122,481,112 S26A probably benign Het
Dbf4 G A 5: 8,403,062 probably benign Het
Ddx23 A T 15: 98,647,235 D663E probably benign Het
Dpep2 T C 8: 105,990,756 T123A possibly damaging Het
Eed A G 7: 89,964,768 I274T probably damaging Het
Eif3b A G 5: 140,419,500 D47G probably benign Het
Epas1 T C 17: 86,805,758 V124A probably damaging Het
Fam129a A T 1: 151,715,694 D529V probably damaging Het
Fer1l6 T C 15: 58,577,949 L668P probably damaging Het
Fnip2 C A 3: 79,465,721 E1017* probably null Het
Gm43517 A T 12: 49,389,907 probably benign Het
Got1 A G 19: 43,502,906 probably null Het
H2-Eb2 T A 17: 34,334,401 V187E probably damaging Het
H2-Q1 T C 17: 35,321,266 probably benign Het
Hpgd T C 8: 56,298,419 V94A probably damaging Het
Htra1 T A 7: 130,985,026 N446K probably benign Het
Igkv3-4 T A 6: 70,672,285 S89R probably damaging Het
Immt C T 6: 71,852,736 T142I probably damaging Het
Itpkb C A 1: 180,418,194 P759T probably damaging Het
Jmjd1c G A 10: 67,224,792 V688I possibly damaging Het
Kbtbd13 G T 9: 65,390,743 R304S probably benign Het
Lama5 A C 2: 180,185,941 L2176R probably damaging Het
Lrp1b G C 2: 40,661,532 L418V probably null Het
Lrrc4b C A 7: 44,462,372 probably null Het
Lyst A G 13: 13,740,597 N3292S probably damaging Het
Mep1b A T 18: 21,086,184 I132F probably benign Het
Mettl2 A G 11: 105,126,610 probably null Het
Nmd3 T C 3: 69,745,236 L385S probably benign Het
Nol4 T C 18: 22,912,626 E243G probably damaging Het
Olfr1052 A T 2: 86,298,698 N294I possibly damaging Het
Olfr639 A G 7: 104,012,588 I38T probably benign Het
Olfr723 T A 14: 49,929,269 I92F probably damaging Het
Olfr917 A G 9: 38,665,223 I207T probably benign Het
Pcnp A G 16: 56,017,159 probably benign Het
Pla2g6 A C 15: 79,287,618 C680G probably damaging Het
Plekha7 G T 7: 116,144,943 D661E probably damaging Het
Prim1 A T 10: 128,027,018 probably benign Het
Psg29 T A 7: 17,210,535 N323K probably benign Het
Ptrh2 G A 11: 86,690,007 R150H probably damaging Het
Rasa1 A G 13: 85,250,502 probably benign Het
Rasa3 T C 8: 13,577,501 D667G probably benign Het
Rnase2a T C 14: 51,255,744 N55D probably damaging Het
Rsf1 GCGGCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,916 probably benign Het
Sbp T A 17: 23,945,244 N133K probably damaging Het
Scml4 A G 10: 42,957,747 probably benign Het
Sema5b T A 16: 35,663,182 N1063K probably damaging Het
Serpind1 C T 16: 17,336,408 T33M probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc15a2 A T 16: 36,781,695 L80* probably null Het
Slc9a3r2 T C 17: 24,644,899 M1V probably null Het
Sorcs3 A G 19: 48,794,163 D1039G probably benign Het
Spon1 A G 7: 114,039,867 E776G probably damaging Het
Tdp1 C T 12: 99,902,364 A259V possibly damaging Het
Tex46 C A 4: 136,610,680 P61Q probably benign Het
Tnr T A 1: 159,897,066 L1109Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpra1 G A 6: 88,910,679 probably benign Het
Trim43c A T 9: 88,847,652 H383L possibly damaging Het
Trip6 A G 5: 137,310,171 C439R probably damaging Het
Tubgcp2 T C 7: 139,996,161 D863G probably damaging Het
Ube2d2a A G 18: 35,770,445 probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc5c A T 3: 141,828,517 E933V probably damaging Het
Vmn1r208 A G 13: 22,772,476 F284L probably benign Het
Vmn2r53 T A 7: 12,600,765 R323* probably null Het
Zan G A 5: 137,389,019 T4924I unknown Het
Zfp597 G T 16: 3,865,987 Q302K probably benign Het
Other mutations in Tsen2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Tsen2 APN 6 115576984 missense probably damaging 1.00
IGL01409:Tsen2 APN 6 115559594 missense possibly damaging 0.72
IGL02002:Tsen2 APN 6 115559607 missense probably benign 0.12
IGL03301:Tsen2 APN 6 115568771 missense probably damaging 1.00
FR4304:Tsen2 UTSW 6 115560069 small insertion probably benign
FR4340:Tsen2 UTSW 6 115560066 small insertion probably benign
FR4340:Tsen2 UTSW 6 115560069 small insertion probably benign
FR4342:Tsen2 UTSW 6 115560072 small insertion probably benign
FR4548:Tsen2 UTSW 6 115560068 small insertion probably benign
FR4737:Tsen2 UTSW 6 115560077 small insertion probably benign
FR4976:Tsen2 UTSW 6 115560066 small insertion probably benign
R0141:Tsen2 UTSW 6 115568829 missense probably damaging 0.99
R1165:Tsen2 UTSW 6 115561435 missense probably damaging 1.00
R1528:Tsen2 UTSW 6 115560028 missense probably benign 0.01
R2152:Tsen2 UTSW 6 115547975 missense possibly damaging 0.94
R4022:Tsen2 UTSW 6 115547987 missense probably damaging 1.00
R4246:Tsen2 UTSW 6 115547824 splice site probably benign
R4247:Tsen2 UTSW 6 115547824 splice site probably benign
R4249:Tsen2 UTSW 6 115547824 splice site probably benign
R5511:Tsen2 UTSW 6 115561404 missense probably damaging 1.00
R5580:Tsen2 UTSW 6 115577980 missense probably damaging 1.00
R5935:Tsen2 UTSW 6 115559595 missense probably damaging 1.00
R6086:Tsen2 UTSW 6 115560075 missense probably benign 0.35
R6457:Tsen2 UTSW 6 115559631 missense probably benign 0.01
R6750:Tsen2 UTSW 6 115549920 missense probably damaging 1.00
R7009:Tsen2 UTSW 6 115547972 missense possibly damaging 0.94
R7438:Tsen2 UTSW 6 115559982 nonsense probably null
RF030:Tsen2 UTSW 6 115560067 small insertion probably benign
RF035:Tsen2 UTSW 6 115560067 small insertion probably benign
RF042:Tsen2 UTSW 6 115560067 small insertion probably benign
RF056:Tsen2 UTSW 6 115560064 small insertion probably benign
Z1176:Tsen2 UTSW 6 115559916 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGCAGGCAATGTGAAGTTCT -3'
(R):5'- CAGCCGTACAAATAACTTAAGATTTTC -3'

Sequencing Primer
(F):5'- CAGGCAATGTGAAGTTCTTCTGTCC -3'
(R):5'- CAATGTGAGCTTTTAGCCACCGAG -3'
Posted On2015-12-29