Incidental Mutation 'R4774:Blm'
ID 367759
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene Name Bloom syndrome, RecQ like helicase
Synonyms
MMRRC Submission 042412-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4774 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 80454733-80535119 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80463848 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 1234 (C1234S)
Ref Sequence ENSEMBL: ENSMUSP00000127995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
AlphaFold O88700
Predicted Effect probably damaging
Transcript: ENSMUST00000081314
AA Change: C1231S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: C1231S

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170315
AA Change: C1234S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: C1234S

DomainStartEndE-ValueType
Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205730
Predicted Effect unknown
Transcript: ENSMUST00000206901
AA Change: C10S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206948
Predicted Effect probably benign
Transcript: ENSMUST00000206989
Meta Mutation Damage Score 0.6740 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,317 (GRCm38) I844V probably damaging Het
Acnat1 T A 4: 49,450,784 (GRCm38) Y109F probably benign Het
Alox12b T C 11: 69,163,207 (GRCm38) V205A probably benign Het
Apopt1 A G 12: 111,713,389 (GRCm38) T33A possibly damaging Het
Arl6ip1 G A 7: 118,121,985 (GRCm38) R77C probably damaging Het
Atp8b1 A G 18: 64,533,659 (GRCm38) C1156R possibly damaging Het
Atp8b3 A C 10: 80,536,322 (GRCm38) N24K probably damaging Het
Bdh1 T C 16: 31,455,136 (GRCm38) V209A possibly damaging Het
Caml A G 13: 55,631,927 (GRCm38) D271G possibly damaging Het
Capn11 T C 17: 45,633,080 (GRCm38) D545G probably benign Het
Catspere1 T C 1: 177,937,738 (GRCm38) noncoding transcript Het
Ccdc114 T A 7: 45,948,380 (GRCm38) S571R probably damaging Het
Cep128 T C 12: 91,234,195 (GRCm38) E347G probably damaging Het
Cngb3 A G 4: 19,415,713 (GRCm38) T408A possibly damaging Het
Cog1 G A 11: 113,657,427 (GRCm38) R18Q possibly damaging Het
Cps1 T C 1: 67,220,512 (GRCm38) F1338L probably damaging Het
Csmd1 T C 8: 16,009,369 (GRCm38) H2122R probably benign Het
Ctu2 T G 8: 122,481,112 (GRCm38) S26A probably benign Het
Dbf4 G A 5: 8,403,062 (GRCm38) probably benign Het
Ddx23 A T 15: 98,647,235 (GRCm38) D663E probably benign Het
Dpep2 T C 8: 105,990,756 (GRCm38) T123A possibly damaging Het
Eed A G 7: 89,964,768 (GRCm38) I274T probably damaging Het
Eif3b A G 5: 140,419,500 (GRCm38) D47G probably benign Het
Epas1 T C 17: 86,805,758 (GRCm38) V124A probably damaging Het
Fam129a A T 1: 151,715,694 (GRCm38) D529V probably damaging Het
Fer1l6 T C 15: 58,577,949 (GRCm38) L668P probably damaging Het
Fnip2 C A 3: 79,465,721 (GRCm38) E1017* probably null Het
Gm43517 A T 12: 49,389,907 (GRCm38) probably benign Het
Got1 A G 19: 43,502,906 (GRCm38) probably null Het
H2-Eb2 T A 17: 34,334,401 (GRCm38) V187E probably damaging Het
H2-Q1 T C 17: 35,321,266 (GRCm38) probably benign Het
Hpgd T C 8: 56,298,419 (GRCm38) V94A probably damaging Het
Htra1 T A 7: 130,985,026 (GRCm38) N446K probably benign Het
Igkv3-4 T A 6: 70,672,285 (GRCm38) S89R probably damaging Het
Immt C T 6: 71,852,736 (GRCm38) T142I probably damaging Het
Itpkb C A 1: 180,418,194 (GRCm38) P759T probably damaging Het
Jmjd1c G A 10: 67,224,792 (GRCm38) V688I possibly damaging Het
Kbtbd13 G T 9: 65,390,743 (GRCm38) R304S probably benign Het
Lama5 A C 2: 180,185,941 (GRCm38) L2176R probably damaging Het
Lrp1b G C 2: 40,661,532 (GRCm38) L418V probably null Het
Lrrc4b C A 7: 44,462,372 (GRCm38) probably null Het
Lyst A G 13: 13,740,597 (GRCm38) N3292S probably damaging Het
Mep1b A T 18: 21,086,184 (GRCm38) I132F probably benign Het
Mettl2 A G 11: 105,126,610 (GRCm38) probably null Het
Nmd3 T C 3: 69,745,236 (GRCm38) L385S probably benign Het
Nol4 T C 18: 22,912,626 (GRCm38) E243G probably damaging Het
Olfr1052 A T 2: 86,298,698 (GRCm38) N294I possibly damaging Het
Olfr639 A G 7: 104,012,588 (GRCm38) I38T probably benign Het
Olfr723 T A 14: 49,929,269 (GRCm38) I92F probably damaging Het
Olfr917 A G 9: 38,665,223 (GRCm38) I207T probably benign Het
Pcnp A G 16: 56,017,159 (GRCm38) probably benign Het
Pla2g6 A C 15: 79,287,618 (GRCm38) C680G probably damaging Het
Plekha7 G T 7: 116,144,943 (GRCm38) D661E probably damaging Het
Prim1 A T 10: 128,027,018 (GRCm38) probably benign Het
Psg29 T A 7: 17,210,535 (GRCm38) N323K probably benign Het
Ptrh2 G A 11: 86,690,007 (GRCm38) R150H probably damaging Het
Rasa1 A G 13: 85,250,502 (GRCm38) probably benign Het
Rasa3 T C 8: 13,577,501 (GRCm38) D667G probably benign Het
Rnase2a T C 14: 51,255,744 (GRCm38) N55D probably damaging Het
Rsf1 GCGGCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,916 (GRCm38) probably benign Het
Sbp T A 17: 23,945,244 (GRCm38) N133K probably damaging Het
Scml4 A G 10: 42,957,747 (GRCm38) probably benign Het
Sema5b T A 16: 35,663,182 (GRCm38) N1063K probably damaging Het
Serpind1 C T 16: 17,336,408 (GRCm38) T33M probably benign Het
Shroom3 G T 5: 92,943,086 (GRCm38) V1151F probably damaging Het
Slc15a2 A T 16: 36,781,695 (GRCm38) L80* probably null Het
Slc9a3r2 T C 17: 24,644,899 (GRCm38) M1V probably null Het
Sorcs3 A G 19: 48,794,163 (GRCm38) D1039G probably benign Het
Spon1 A G 7: 114,039,867 (GRCm38) E776G probably damaging Het
Tdp1 C T 12: 99,902,364 (GRCm38) A259V possibly damaging Het
Tex46 C A 4: 136,610,680 (GRCm38) P61Q probably benign Het
Tnr T A 1: 159,897,066 (GRCm38) L1109Q probably damaging Het
Tns2 C T 15: 102,108,934 (GRCm38) R281C probably damaging Het
Tpra1 G A 6: 88,910,679 (GRCm38) probably benign Het
Trim43c A T 9: 88,847,652 (GRCm38) H383L possibly damaging Het
Trip6 A G 5: 137,310,171 (GRCm38) C439R probably damaging Het
Tsen2 C T 6: 115,575,933 (GRCm38) S398L possibly damaging Het
Tubgcp2 T C 7: 139,996,161 (GRCm38) D863G probably damaging Het
Ube2d2a A G 18: 35,770,445 (GRCm38) probably benign Het
Umad1 T A 6: 8,427,181 (GRCm38) F145I probably damaging Het
Unc5c A T 3: 141,828,517 (GRCm38) E933V probably damaging Het
Vmn1r208 A G 13: 22,772,476 (GRCm38) F284L probably benign Het
Vmn2r53 T A 7: 12,600,765 (GRCm38) R323* probably null Het
Zan G A 5: 137,389,019 (GRCm38) T4924I unknown Het
Zfp597 G T 16: 3,865,987 (GRCm38) Q302K probably benign Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80,474,071 (GRCm38) missense probably damaging 1.00
IGL01658:Blm APN 7 80,463,941 (GRCm38) missense probably damaging 0.98
IGL02048:Blm APN 7 80,502,961 (GRCm38) splice site probably benign
IGL02060:Blm APN 7 80,514,580 (GRCm38) splice site probably benign
IGL02063:Blm APN 7 80,509,419 (GRCm38) nonsense probably null
IGL02102:Blm APN 7 80,469,756 (GRCm38) missense probably damaging 1.00
IGL02420:Blm APN 7 80,496,006 (GRCm38) missense probably damaging 1.00
IGL02452:Blm APN 7 80,503,377 (GRCm38) splice site probably null
IGL02566:Blm APN 7 80,474,196 (GRCm38) missense probably damaging 1.00
IGL03387:Blm APN 7 80,494,147 (GRCm38) missense probably damaging 1.00
FR4304:Blm UTSW 7 80,512,919 (GRCm38) small insertion probably benign
FR4304:Blm UTSW 7 80,463,773 (GRCm38) frame shift probably null
FR4340:Blm UTSW 7 80,512,910 (GRCm38) small insertion probably benign
FR4340:Blm UTSW 7 80,512,907 (GRCm38) small insertion probably benign
FR4340:Blm UTSW 7 80,463,767 (GRCm38) unclassified probably benign
FR4449:Blm UTSW 7 80,512,908 (GRCm38) small insertion probably benign
FR4548:Blm UTSW 7 80,463,769 (GRCm38) frame shift probably null
FR4589:Blm UTSW 7 80,463,770 (GRCm38) frame shift probably null
FR4737:Blm UTSW 7 80,463,774 (GRCm38) frame shift probably null
FR4737:Blm UTSW 7 80,463,771 (GRCm38) frame shift probably null
FR4976:Blm UTSW 7 80,512,907 (GRCm38) small insertion probably benign
FR4976:Blm UTSW 7 80,463,767 (GRCm38) unclassified probably benign
R0133:Blm UTSW 7 80,502,367 (GRCm38) missense possibly damaging 0.93
R0194:Blm UTSW 7 80,464,946 (GRCm38) unclassified probably benign
R0526:Blm UTSW 7 80,505,893 (GRCm38) nonsense probably null
R0673:Blm UTSW 7 80,499,751 (GRCm38) critical splice donor site probably null
R0972:Blm UTSW 7 80,513,370 (GRCm38) missense probably benign
R0980:Blm UTSW 7 80,499,958 (GRCm38) splice site probably null
R1120:Blm UTSW 7 80,481,466 (GRCm38) missense probably damaging 1.00
R1301:Blm UTSW 7 80,455,417 (GRCm38) nonsense probably null
R1769:Blm UTSW 7 80,513,370 (GRCm38) missense probably benign
R1866:Blm UTSW 7 80,494,114 (GRCm38) missense probably benign 0.08
R1874:Blm UTSW 7 80,497,418 (GRCm38) missense probably damaging 1.00
R1966:Blm UTSW 7 80,513,186 (GRCm38) missense possibly damaging 0.86
R1991:Blm UTSW 7 80,505,949 (GRCm38) splice site probably null
R2013:Blm UTSW 7 80,502,399 (GRCm38) missense probably damaging 0.99
R2014:Blm UTSW 7 80,502,399 (GRCm38) missense probably damaging 0.99
R2015:Blm UTSW 7 80,502,399 (GRCm38) missense probably damaging 0.99
R2016:Blm UTSW 7 80,505,926 (GRCm38) missense probably benign 0.26
R2103:Blm UTSW 7 80,505,949 (GRCm38) splice site probably null
R2161:Blm UTSW 7 80,481,370 (GRCm38) splice site probably null
R2215:Blm UTSW 7 80,499,847 (GRCm38) missense possibly damaging 0.69
R3689:Blm UTSW 7 80,513,079 (GRCm38) missense possibly damaging 0.56
R4049:Blm UTSW 7 80,502,862 (GRCm38) missense probably benign 0.04
R4155:Blm UTSW 7 80,512,904 (GRCm38) small deletion probably benign
R4695:Blm UTSW 7 80,494,228 (GRCm38) missense probably damaging 1.00
R4833:Blm UTSW 7 80,466,826 (GRCm38) missense probably benign
R4835:Blm UTSW 7 80,509,546 (GRCm38) missense probably benign 0.41
R4994:Blm UTSW 7 80,458,825 (GRCm38) missense probably benign 0.00
R5039:Blm UTSW 7 80,505,873 (GRCm38) missense possibly damaging 0.50
R5330:Blm UTSW 7 80,458,936 (GRCm38) missense possibly damaging 0.73
R5375:Blm UTSW 7 80,513,229 (GRCm38) missense probably benign 0.00
R5408:Blm UTSW 7 80,502,622 (GRCm38) missense probably benign 0.01
R5574:Blm UTSW 7 80,499,773 (GRCm38) missense probably damaging 1.00
R5606:Blm UTSW 7 80,460,832 (GRCm38) splice site probably null
R5702:Blm UTSW 7 80,458,927 (GRCm38) missense probably benign 0.13
R5809:Blm UTSW 7 80,464,844 (GRCm38) missense probably damaging 1.00
R6114:Blm UTSW 7 80,513,487 (GRCm38) missense probably damaging 1.00
R6157:Blm UTSW 7 80,512,985 (GRCm38) missense probably benign 0.18
R6163:Blm UTSW 7 80,512,904 (GRCm38) small deletion probably benign
R6254:Blm UTSW 7 80,480,342 (GRCm38) missense probably benign 0.04
R6266:Blm UTSW 7 80,499,940 (GRCm38) missense probably benign 0.03
R6364:Blm UTSW 7 80,494,526 (GRCm38) nonsense probably null
R6446:Blm UTSW 7 80,512,904 (GRCm38) small deletion probably benign
R6502:Blm UTSW 7 80,481,475 (GRCm38) missense probably damaging 0.98
R6700:Blm UTSW 7 80,463,850 (GRCm38) missense possibly damaging 0.91
R7002:Blm UTSW 7 80,469,753 (GRCm38) missense probably benign 0.00
R7105:Blm UTSW 7 80,499,768 (GRCm38) missense probably benign 0.44
R7320:Blm UTSW 7 80,455,354 (GRCm38) nonsense probably null
R7465:Blm UTSW 7 80,513,115 (GRCm38) missense probably benign 0.02
R7561:Blm UTSW 7 80,502,528 (GRCm38) missense probably damaging 0.99
R8500:Blm UTSW 7 80,455,284 (GRCm38) missense probably damaging 1.00
R8543:Blm UTSW 7 80,494,216 (GRCm38) missense probably damaging 0.98
R8774-TAIL:Blm UTSW 7 80,512,907 (GRCm38) small insertion probably benign
R8774-TAIL:Blm UTSW 7 80,512,918 (GRCm38) small insertion probably benign
R8774-TAIL:Blm UTSW 7 80,512,919 (GRCm38) small insertion probably benign
R8775-TAIL:Blm UTSW 7 80,512,931 (GRCm38) small insertion probably benign
R8860:Blm UTSW 7 80,494,528 (GRCm38) missense probably benign 0.30
R8928:Blm UTSW 7 80,512,904 (GRCm38) small deletion probably benign
R9089:Blm UTSW 7 80,513,119 (GRCm38) missense probably damaging 1.00
R9363:Blm UTSW 7 80,458,915 (GRCm38) missense probably damaging 1.00
RF001:Blm UTSW 7 80,512,927 (GRCm38) small insertion probably benign
RF001:Blm UTSW 7 80,512,906 (GRCm38) small insertion probably benign
RF001:Blm UTSW 7 80,512,903 (GRCm38) small insertion probably benign
RF002:Blm UTSW 7 80,512,927 (GRCm38) small insertion probably benign
RF002:Blm UTSW 7 80,512,905 (GRCm38) small insertion probably benign
RF007:Blm UTSW 7 80,512,933 (GRCm38) nonsense probably null
RF016:Blm UTSW 7 80,512,926 (GRCm38) nonsense probably null
RF018:Blm UTSW 7 80,512,926 (GRCm38) nonsense probably null
RF027:Blm UTSW 7 80,512,914 (GRCm38) frame shift probably null
RF028:Blm UTSW 7 80,512,905 (GRCm38) nonsense probably null
RF031:Blm UTSW 7 80,512,923 (GRCm38) small insertion probably benign
RF031:Blm UTSW 7 80,512,906 (GRCm38) small insertion probably benign
RF032:Blm UTSW 7 80,512,930 (GRCm38) small insertion probably benign
RF036:Blm UTSW 7 80,512,914 (GRCm38) nonsense probably null
RF044:Blm UTSW 7 80,512,930 (GRCm38) small insertion probably benign
RF053:Blm UTSW 7 80,512,921 (GRCm38) small insertion probably benign
RF064:Blm UTSW 7 80,512,923 (GRCm38) nonsense probably null
X0061:Blm UTSW 7 80,458,850 (GRCm38) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGTTGAAAACCCAGAGATTAAACC -3'
(R):5'- TGGGAAAAGCTTTCTGGGTAC -3'

Sequencing Primer
(F):5'- CAGACCTCTGTGAGTTCAAGGTCAG -3'
(R):5'- AAAAGCTTTCTGGGTACAGTGTGC -3'
Posted On 2015-12-29