Incidental Mutation 'R4774:Ddx23'
ID367795
Institutional Source Beutler Lab
Gene Symbol Ddx23
Ensembl Gene ENSMUSG00000003360
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Synonyms
MMRRC Submission 042412-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4774 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98645134-98662894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98647235 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 663 (D663E)
Ref Sequence ENSEMBL: ENSMUSP00000003450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003442] [ENSMUST00000003450] [ENSMUST00000109150] [ENSMUST00000230490]
Predicted Effect probably benign
Transcript: ENSMUST00000003442
SMART Domains Protein: ENSMUSP00000003442
Gene: ENSMUSG00000003352

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 16 58 8.7e-22 PFAM
SH3 62 125 1.04e0 SMART
GuKc 176 357 1.3e-32 SMART
low complexity region 363 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000003450
AA Change: D663E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003450
Gene: ENSMUSG00000003360
AA Change: D663E

DomainStartEndE-ValueType
coiled coil region 63 93 N/A INTRINSIC
low complexity region 110 130 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 161 200 N/A INTRINSIC
low complexity region 210 223 N/A INTRINSIC
coiled coil region 320 352 N/A INTRINSIC
DEXDc 409 641 2.95e-65 SMART
HELICc 677 758 2.43e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109150
SMART Domains Protein: ENSMUSP00000104778
Gene: ENSMUSG00000003352

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 15 57 2.2e-21 PFAM
SH3 61 124 1.04e0 SMART
GuKc 175 356 1.3e-32 SMART
low complexity region 362 378 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230064
Predicted Effect probably benign
Transcript: ENSMUST00000230490
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a component of the U5 snRNP complex; it may facilitate conformational changes in the spliceosome during nuclear pre-mRNA splicing. An alternatively spliced transcript variant has been found for this gene, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,317 I844V probably damaging Het
Acnat1 T A 4: 49,450,784 Y109F probably benign Het
Alox12b T C 11: 69,163,207 V205A probably benign Het
Apopt1 A G 12: 111,713,389 T33A possibly damaging Het
Arl6ip1 G A 7: 118,121,985 R77C probably damaging Het
Atp8b1 A G 18: 64,533,659 C1156R possibly damaging Het
Atp8b3 A C 10: 80,536,322 N24K probably damaging Het
Bdh1 T C 16: 31,455,136 V209A possibly damaging Het
Blm A T 7: 80,463,848 C1234S probably damaging Het
Caml A G 13: 55,631,927 D271G possibly damaging Het
Capn11 T C 17: 45,633,080 D545G probably benign Het
Catspere1 T C 1: 177,937,738 noncoding transcript Het
Ccdc114 T A 7: 45,948,380 S571R probably damaging Het
Cep128 T C 12: 91,234,195 E347G probably damaging Het
Cngb3 A G 4: 19,415,713 T408A possibly damaging Het
Cog1 G A 11: 113,657,427 R18Q possibly damaging Het
Cps1 T C 1: 67,220,512 F1338L probably damaging Het
Csmd1 T C 8: 16,009,369 H2122R probably benign Het
Ctu2 T G 8: 122,481,112 S26A probably benign Het
Dbf4 G A 5: 8,403,062 probably benign Het
Dpep2 T C 8: 105,990,756 T123A possibly damaging Het
Eed A G 7: 89,964,768 I274T probably damaging Het
Eif3b A G 5: 140,419,500 D47G probably benign Het
Epas1 T C 17: 86,805,758 V124A probably damaging Het
Fam129a A T 1: 151,715,694 D529V probably damaging Het
Fer1l6 T C 15: 58,577,949 L668P probably damaging Het
Fnip2 C A 3: 79,465,721 E1017* probably null Het
Gm43517 A T 12: 49,389,907 probably benign Het
Got1 A G 19: 43,502,906 probably null Het
H2-Eb2 T A 17: 34,334,401 V187E probably damaging Het
H2-Q1 T C 17: 35,321,266 probably benign Het
Hpgd T C 8: 56,298,419 V94A probably damaging Het
Htra1 T A 7: 130,985,026 N446K probably benign Het
Igkv3-4 T A 6: 70,672,285 S89R probably damaging Het
Immt C T 6: 71,852,736 T142I probably damaging Het
Itpkb C A 1: 180,418,194 P759T probably damaging Het
Jmjd1c G A 10: 67,224,792 V688I possibly damaging Het
Kbtbd13 G T 9: 65,390,743 R304S probably benign Het
Lama5 A C 2: 180,185,941 L2176R probably damaging Het
Lrp1b G C 2: 40,661,532 L418V probably null Het
Lrrc4b C A 7: 44,462,372 probably null Het
Lyst A G 13: 13,740,597 N3292S probably damaging Het
Mep1b A T 18: 21,086,184 I132F probably benign Het
Mettl2 A G 11: 105,126,610 probably null Het
Nmd3 T C 3: 69,745,236 L385S probably benign Het
Nol4 T C 18: 22,912,626 E243G probably damaging Het
Olfr1052 A T 2: 86,298,698 N294I possibly damaging Het
Olfr639 A G 7: 104,012,588 I38T probably benign Het
Olfr723 T A 14: 49,929,269 I92F probably damaging Het
Olfr917 A G 9: 38,665,223 I207T probably benign Het
Pcnp A G 16: 56,017,159 probably benign Het
Pla2g6 A C 15: 79,287,618 C680G probably damaging Het
Plekha7 G T 7: 116,144,943 D661E probably damaging Het
Prim1 A T 10: 128,027,018 probably benign Het
Psg29 T A 7: 17,210,535 N323K probably benign Het
Ptrh2 G A 11: 86,690,007 R150H probably damaging Het
Rasa1 A G 13: 85,250,502 probably benign Het
Rasa3 T C 8: 13,577,501 D667G probably benign Het
Rnase2a T C 14: 51,255,744 N55D probably damaging Het
Rsf1 GCGGCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,916 probably benign Het
Sbp T A 17: 23,945,244 N133K probably damaging Het
Scml4 A G 10: 42,957,747 probably benign Het
Sema5b T A 16: 35,663,182 N1063K probably damaging Het
Serpind1 C T 16: 17,336,408 T33M probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc15a2 A T 16: 36,781,695 L80* probably null Het
Slc9a3r2 T C 17: 24,644,899 M1V probably null Het
Sorcs3 A G 19: 48,794,163 D1039G probably benign Het
Spon1 A G 7: 114,039,867 E776G probably damaging Het
Tdp1 C T 12: 99,902,364 A259V possibly damaging Het
Tex46 C A 4: 136,610,680 P61Q probably benign Het
Tnr T A 1: 159,897,066 L1109Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpra1 G A 6: 88,910,679 probably benign Het
Trim43c A T 9: 88,847,652 H383L possibly damaging Het
Trip6 A G 5: 137,310,171 C439R probably damaging Het
Tsen2 C T 6: 115,575,933 S398L possibly damaging Het
Tubgcp2 T C 7: 139,996,161 D863G probably damaging Het
Ube2d2a A G 18: 35,770,445 probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc5c A T 3: 141,828,517 E933V probably damaging Het
Vmn1r208 A G 13: 22,772,476 F284L probably benign Het
Vmn2r53 T A 7: 12,600,765 R323* probably null Het
Zan G A 5: 137,389,019 T4924I unknown Het
Zfp597 G T 16: 3,865,987 Q302K probably benign Het
Other mutations in Ddx23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Ddx23 APN 15 98650940 missense probably benign 0.02
IGL02320:Ddx23 APN 15 98650938 missense possibly damaging 0.68
IGL02325:Ddx23 APN 15 98647193 missense possibly damaging 0.80
IGL02456:Ddx23 APN 15 98647549 missense probably damaging 1.00
IGL02514:Ddx23 APN 15 98658318 missense unknown
IGL03173:Ddx23 APN 15 98651004 missense probably benign 0.31
R0077:Ddx23 UTSW 15 98656600 critical splice donor site probably null
R1930:Ddx23 UTSW 15 98650718 missense possibly damaging 0.93
R1931:Ddx23 UTSW 15 98650718 missense possibly damaging 0.93
R1932:Ddx23 UTSW 15 98650718 missense possibly damaging 0.93
R3546:Ddx23 UTSW 15 98650732 missense probably damaging 0.99
R4174:Ddx23 UTSW 15 98658251 missense unknown
R4574:Ddx23 UTSW 15 98647624 missense probably damaging 1.00
R4728:Ddx23 UTSW 15 98650225 missense probably damaging 1.00
R4811:Ddx23 UTSW 15 98647471 splice site probably null
R5134:Ddx23 UTSW 15 98650770 missense possibly damaging 0.48
R5895:Ddx23 UTSW 15 98651951 missense probably benign 0.00
R5952:Ddx23 UTSW 15 98658240 missense unknown
R6012:Ddx23 UTSW 15 98650770 missense possibly damaging 0.48
R6289:Ddx23 UTSW 15 98649884 missense probably benign 0.05
R6705:Ddx23 UTSW 15 98652968 nonsense probably null
R7289:Ddx23 UTSW 15 98648611 missense probably damaging 0.98
R7484:Ddx23 UTSW 15 98648689 missense probably damaging 0.99
R7543:Ddx23 UTSW 15 98658258 missense unknown
R7740:Ddx23 UTSW 15 98658434 start codon destroyed probably null
Z1088:Ddx23 UTSW 15 98647621 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTAAACAGTGAGTGGAGCCG -3'
(R):5'- AGGTCTTCCTCATGTCGGAATC -3'

Sequencing Primer
(F):5'- GACACTCCCCACTCCATTCCTAG -3'
(R):5'- CTTCCTCATGTCGGAATCAGAAAAG -3'
Posted On2015-12-29