Mutagenetix > Incidental Mutations

Incidental Mutation 'R4775:Stk11ip'

367819

Institutional Source

Beutler Lab

Gene Symbol

Stk11ip

Ensembl Gene

ENSMUSG00000026213

Gene Name

serine/threonine kinase 11 interacting protein

Synonyms

1200014D22Rik, LKB1IP, LIP1

MMRRC Submission

041991-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4775 (G1)

Quality Score

121

Status

Not validated

Chromosome

Chromosomal Location

75521529-75537335 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75533853 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 864 (W864R)

Ref Sequence

ENSEMBL: ENSMUSP00000109182 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027414] [ENSMUST00000113553]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027414
AA Change: W864R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000027414
Gene: ENSMUSG00000026213
AA Change: W864R

Domain	Start	End	E-Value	Type
low complexity region	25	41	N/A	INTRINSIC
SCOP:d1h6ua2	74	291	2e-19	SMART
Blast:LRR	208	231	2e-6	BLAST
Blast:LRR	253	276	5e-6	BLAST
Blast:LRR	278	304	2e-8	BLAST
low complexity region	376	386	N/A	INTRINSIC
coiled coil region	495	528	N/A	INTRINSIC
low complexity region	752	767	N/A	INTRINSIC
low complexity region	948	959	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113553
AA Change: W864R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000109182
Gene: ENSMUSG00000026213
AA Change: W864R

Domain	Start	End	E-Value	Type
Pfam:LIP1	4	94	2.9e-45	PFAM
low complexity region	175	194	N/A	INTRINSIC
Blast:LRR	208	231	2e-6	BLAST
Blast:LRR	253	276	5e-6	BLAST
Blast:LRR	278	304	2e-8	BLAST
low complexity region	376	386	N/A	INTRINSIC
coiled coil region	495	528	N/A	INTRINSIC
low complexity region	752	767	N/A	INTRINSIC
low complexity region	948	959	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129794

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140963

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146575

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150560

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154303

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156838

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,243,339	Y426C	probably damaging	Het
Adam7	A	G	14: 68,507,912	I621T	probably benign	Het
Adamts1	A	T	16: 85,800,390	Y260*	probably null	Het
Adgrf1	C	T	17: 43,311,163	L764F	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Atp9b	A	G	18: 80,765,769		probably null	Het
BC067074	A	T	13: 113,317,695	I92F	possibly damaging	Het
C5ar2	A	C	7: 16,237,615	L129R	probably damaging	Het
Ccdc174	G	A	6: 91,890,894		probably null	Het
Cidec	T	C	6: 113,434,734	M1V	probably null	Het
Clec16a	G	T	16: 10,638,914	R663L	probably damaging	Het
Col25a1	T	C	3: 130,182,819	C118R	possibly damaging	Het
Cox6b2	A	G	7: 4,752,075	C67R	probably damaging	Het
Cwf19l2	A	G	9: 3,430,973	Y435C	probably benign	Het
Dapk1	T	A	13: 60,749,342	S792T	probably benign	Het
Dis3l	T	A	9: 64,330,908	N101Y	probably benign	Het
Dsg4	A	G	18: 20,471,127	T884A	possibly damaging	Het
Dvl1	T	C	4: 155,858,127	W617R	probably benign	Het
Eml5	A	G	12: 98,802,307	V1503A	probably benign	Het
Engase	A	T	11: 118,482,671	D280V	probably benign	Het
F11r	T	C	1: 171,461,641	S224P	probably damaging	Het
Fanca	A	G	8: 123,296,306	V564A	probably damaging	Het
Foxj2	G	T	6: 122,833,271	Q196H	probably benign	Het
Gle1	T	C	2: 29,936,061	W51R	possibly damaging	Het
Gm94	A	G	18: 43,792,771		probably null	Het
Gm9830	A	T	9: 44,464,424		noncoding transcript	Het
Gpaa1	T	A	15: 76,334,691		probably null	Het
Grin1	C	T	2: 25,292,463	A929T	possibly damaging	Het
Grm7	T	A	6: 110,914,371	D188E	probably damaging	Het
Gtf2ird2	T	C	5: 134,214,128	F395L	probably benign	Het
Lipo1	C	A	19: 33,780,395	G225C	probably damaging	Het
Lonrf2	T	A	1: 38,818,059		probably null	Het
Marveld2	A	G	13: 100,616,795		probably benign	Het
Mpl	A	G	4: 118,448,580	L416P	probably damaging	Het
Mppe1	A	G	18: 67,226,859	L312P	possibly damaging	Het
Mpzl3	T	A	9: 45,066,432	S113T	probably damaging	Het
Mylk3	G	A	8: 85,359,060	Q149*	probably null	Het
Myt1	T	A	2: 181,822,677	I968N	probably damaging	Het
Ndc80	A	G	17: 71,514,270	Y228H	probably damaging	Het
Nelfcd	T	G	2: 174,426,576	C520G	probably damaging	Het
Nfrkb	C	A	9: 31,419,049	T1199K	possibly damaging	Het
Nipa2	A	G	7: 55,935,863	I109T	probably benign	Het
Nlrp4e	A	G	7: 23,343,100	T804A	probably benign	Het
Nsf	A	T	11: 103,872,593	I395K	possibly damaging	Het
Nt5c1b	G	A	12: 10,375,449	V331I	probably damaging	Het
Olfr389	A	G	11: 73,776,551	Y259H	probably damaging	Het
Olfr61	A	T	7: 140,637,916	I72F	probably damaging	Het
Pask	T	C	1: 93,337,524	D3G	probably damaging	Het
Pglyrp3	T	C	3: 92,025,730	V110A	possibly damaging	Het
Ppp4r3a	C	T	12: 101,053,566	V377M	probably damaging	Het
Prr12	A	G	7: 45,051,325		probably benign	Het
Ptdss1	G	A	13: 66,987,858		probably null	Het
Qser1	A	G	2: 104,789,901	S189P	probably damaging	Het
Rph3a	T	A	5: 120,954,488	Y350F	probably benign	Het
Skint4	A	T	4: 112,136,064	H328L	probably damaging	Het
Smyd4	G	A	11: 75,391,192	C497Y	probably damaging	Het
Stkld1	T	A	2: 26,951,745	V543E	probably damaging	Het
Taok2	A	G	7: 126,870,768	S963P	probably damaging	Het
Tars2	A	G	3: 95,746,647	L354P	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tpcn2	A	G	7: 145,267,342	L325P	probably damaging	Het
Trappc3l	C	G	10: 34,098,811	H96Q	probably benign	Het
Trim66	A	T	7: 109,457,589	Y1120*	probably null	Het
Trio	G	A	15: 27,881,342	Q548*	probably null	Het
Wipf2	T	A	11: 98,890,732	D32E	probably benign	Het

Other mutations in Stk11ip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00961:Stk11ip	APN	1	75530266	missense	probably damaging	1.00
IGL01776:Stk11ip	APN	1	75527821	missense	probably benign	0.02
IGL02752:Stk11ip	APN	1	75524681	critical splice acceptor site	probably null
IGL03132:Stk11ip	APN	1	75536089	missense	probably benign	0.00
IGL03188:Stk11ip	APN	1	75534435	missense	probably benign	0.00
R6768_Stk11ip_021	UTSW	1	75532635	missense	probably benign
sienna	UTSW	1	75527355	splice site	probably null
R0234:Stk11ip	UTSW	1	75529067	missense	possibly damaging	0.47
R0234:Stk11ip	UTSW	1	75529067	missense	possibly damaging	0.47
R0617:Stk11ip	UTSW	1	75532288	splice site	probably null
R0712:Stk11ip	UTSW	1	75527447	missense	probably damaging	0.99
R1672:Stk11ip	UTSW	1	75528985	nonsense	probably null
R1694:Stk11ip	UTSW	1	75527386	missense	probably damaging	1.00
R1891:Stk11ip	UTSW	1	75532416	missense	probably benign	0.08
R2061:Stk11ip	UTSW	1	75529584	missense	possibly damaging	0.94
R2094:Stk11ip	UTSW	1	75525521	splice site	probably benign
R2851:Stk11ip	UTSW	1	75529267	splice site	probably benign
R2852:Stk11ip	UTSW	1	75529267	splice site	probably benign
R4765:Stk11ip	UTSW	1	75527155	missense	probably damaging	1.00
R4785:Stk11ip	UTSW	1	75530281	missense	possibly damaging	0.95
R5002:Stk11ip	UTSW	1	75532543	intron	probably benign
R5524:Stk11ip	UTSW	1	75532327	missense	probably damaging	1.00
R5538:Stk11ip	UTSW	1	75528335	missense	probably damaging	1.00
R5849:Stk11ip	UTSW	1	75527355	splice site	probably null
R5927:Stk11ip	UTSW	1	75524691	missense	possibly damaging	0.93
R6053:Stk11ip	UTSW	1	75534255	critical splice donor site	probably null
R6485:Stk11ip	UTSW	1	75529968	missense	possibly damaging	0.47
R6734:Stk11ip	UTSW	1	75532369	missense	probably benign	0.04
R6768:Stk11ip	UTSW	1	75532635	missense	probably benign
R7070:Stk11ip	UTSW	1	75527615	missense	probably benign	0.39
R7882:Stk11ip	UTSW	1	75529464	missense	probably benign	0.03
X0066:Stk11ip	UTSW	1	75534426	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCACATGCTTTACCTGTTGAAG -3'
(R):5'- TGGTGAGCATCAAACTGAGC -3'

Sequencing Primer
(F):5'- TGAAGGTGCTAGGGGCCATC -3'
(R):5'- GCAGCCATGACTGAAAGCTCG -3'

Posted On

2015-12-29