Incidental Mutation 'R4775:Gle1'
List |< first << previous [record 24 of 66] next >> last >|
ID367824
Institutional Source Beutler Lab
Gene Symbol Gle1
Ensembl Gene ENSMUSG00000019715
Gene NameGLE1 RNA export mediator (yeast)
Synonyms4933405K21Rik
MMRRC Submission 041991-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4775 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location29935426-29960371 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29936061 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 51 (W51R)
Ref Sequence ENSEMBL: ENSMUSP00000019859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019859] [ENSMUST00000046571] [ENSMUST00000113756] [ENSMUST00000113757] [ENSMUST00000113759] [ENSMUST00000113765] [ENSMUST00000184845]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019859
AA Change: W51R

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019859
Gene: ENSMUSG00000019715
AA Change: W51R

DomainStartEndE-ValueType
low complexity region 67 88 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
coiled coil region 154 275 N/A INTRINSIC
coiled coil region 306 356 N/A INTRINSIC
Pfam:GLE1 397 650 2.4e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046571
SMART Domains Protein: ENSMUSP00000049272
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.77e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.77e-5 PROSPERO
internal_repeat_1 262 298 8.12e-7 PROSPERO
internal_repeat_1 461 495 8.12e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113756
SMART Domains Protein: ENSMUSP00000109385
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.77e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.77e-5 PROSPERO
internal_repeat_1 262 298 8.12e-7 PROSPERO
internal_repeat_1 461 495 8.12e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113757
SMART Domains Protein: ENSMUSP00000109386
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 101 119 9.13e-6 PROSPERO
coiled coil region 120 192 N/A INTRINSIC
internal_repeat_2 199 217 9.13e-6 PROSPERO
internal_repeat_1 243 279 3.83e-7 PROSPERO
internal_repeat_1 442 476 3.83e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113759
SMART Domains Protein: ENSMUSP00000109388
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.82e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.82e-5 PROSPERO
internal_repeat_1 262 299 1.55e-6 PROSPERO
internal_repeat_1 462 496 1.55e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113765
SMART Domains Protein: ENSMUSP00000109394
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 125 143 1.66e-5 PROSPERO
coiled coil region 144 216 N/A INTRINSIC
internal_repeat_2 223 241 1.66e-5 PROSPERO
internal_repeat_1 267 303 7.56e-7 PROSPERO
internal_repeat_1 466 500 7.56e-7 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157723
Predicted Effect probably benign
Transcript: ENSMUST00000184845
SMART Domains Protein: ENSMUSP00000139390
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_1 262 298 3.95e-5 PROSPERO
internal_repeat_1 461 495 3.95e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted 75-kDa polypeptide with high sequence and structure homology to yeast Gle1p, which is nuclear protein with a leucine-rich nuclear export sequence essential for poly(A)+RNA export. Inhibition of human GLE1L by microinjection of antibodies against GLE1L in HeLa cells resulted in inhibition of poly(A)+RNA export. Immunoflourescence studies show that GLE1L is localized at the nuclear pore complexes. This localization suggests that GLE1L may act at a terminal step in the export of mature RNA messages to the cytoplasm. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,243,339 Y426C probably damaging Het
Adam7 A G 14: 68,507,912 I621T probably benign Het
Adamts1 A T 16: 85,800,390 Y260* probably null Het
Adgrf1 C T 17: 43,311,163 L764F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Atp9b A G 18: 80,765,769 probably null Het
BC067074 A T 13: 113,317,695 I92F possibly damaging Het
C5ar2 A C 7: 16,237,615 L129R probably damaging Het
Ccdc174 G A 6: 91,890,894 probably null Het
Cidec T C 6: 113,434,734 M1V probably null Het
Clec16a G T 16: 10,638,914 R663L probably damaging Het
Col25a1 T C 3: 130,182,819 C118R possibly damaging Het
Cox6b2 A G 7: 4,752,075 C67R probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
Dapk1 T A 13: 60,749,342 S792T probably benign Het
Dis3l T A 9: 64,330,908 N101Y probably benign Het
Dsg4 A G 18: 20,471,127 T884A possibly damaging Het
Dvl1 T C 4: 155,858,127 W617R probably benign Het
Eml5 A G 12: 98,802,307 V1503A probably benign Het
Engase A T 11: 118,482,671 D280V probably benign Het
F11r T C 1: 171,461,641 S224P probably damaging Het
Fanca A G 8: 123,296,306 V564A probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gm94 A G 18: 43,792,771 probably null Het
Gm9830 A T 9: 44,464,424 noncoding transcript Het
Gpaa1 T A 15: 76,334,691 probably null Het
Grin1 C T 2: 25,292,463 A929T possibly damaging Het
Grm7 T A 6: 110,914,371 D188E probably damaging Het
Gtf2ird2 T C 5: 134,214,128 F395L probably benign Het
Lipo1 C A 19: 33,780,395 G225C probably damaging Het
Lonrf2 T A 1: 38,818,059 probably null Het
Marveld2 A G 13: 100,616,795 probably benign Het
Mpl A G 4: 118,448,580 L416P probably damaging Het
Mppe1 A G 18: 67,226,859 L312P possibly damaging Het
Mpzl3 T A 9: 45,066,432 S113T probably damaging Het
Mylk3 G A 8: 85,359,060 Q149* probably null Het
Myt1 T A 2: 181,822,677 I968N probably damaging Het
Ndc80 A G 17: 71,514,270 Y228H probably damaging Het
Nelfcd T G 2: 174,426,576 C520G probably damaging Het
Nfrkb C A 9: 31,419,049 T1199K possibly damaging Het
Nipa2 A G 7: 55,935,863 I109T probably benign Het
Nlrp4e A G 7: 23,343,100 T804A probably benign Het
Nsf A T 11: 103,872,593 I395K possibly damaging Het
Nt5c1b G A 12: 10,375,449 V331I probably damaging Het
Olfr389 A G 11: 73,776,551 Y259H probably damaging Het
Olfr61 A T 7: 140,637,916 I72F probably damaging Het
Pask T C 1: 93,337,524 D3G probably damaging Het
Pglyrp3 T C 3: 92,025,730 V110A possibly damaging Het
Ppp4r3a C T 12: 101,053,566 V377M probably damaging Het
Prr12 A G 7: 45,051,325 probably benign Het
Ptdss1 G A 13: 66,987,858 probably null Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rph3a T A 5: 120,954,488 Y350F probably benign Het
Skint4 A T 4: 112,136,064 H328L probably damaging Het
Smyd4 G A 11: 75,391,192 C497Y probably damaging Het
Stk11ip T C 1: 75,533,853 W864R possibly damaging Het
Stkld1 T A 2: 26,951,745 V543E probably damaging Het
Taok2 A G 7: 126,870,768 S963P probably damaging Het
Tars2 A G 3: 95,746,647 L354P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn2 A G 7: 145,267,342 L325P probably damaging Het
Trappc3l C G 10: 34,098,811 H96Q probably benign Het
Trim66 A T 7: 109,457,589 Y1120* probably null Het
Trio G A 15: 27,881,342 Q548* probably null Het
Wipf2 T A 11: 98,890,732 D32E probably benign Het
Other mutations in Gle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Gle1 APN 2 29939289 splice site probably benign
IGL01880:Gle1 APN 2 29943750 missense possibly damaging 0.53
IGL02293:Gle1 APN 2 29957760 missense probably benign 0.00
IGL02859:Gle1 APN 2 29949228 missense probably damaging 1.00
IGL03368:Gle1 APN 2 29943793 missense probably damaging 1.00
R0535:Gle1 UTSW 2 29957805 missense probably damaging 1.00
R0608:Gle1 UTSW 2 29940228 missense probably benign 0.01
R0839:Gle1 UTSW 2 29958450 missense probably benign 0.28
R0908:Gle1 UTSW 2 29936121 missense probably benign 0.06
R1102:Gle1 UTSW 2 29944054 missense possibly damaging 0.88
R1202:Gle1 UTSW 2 29949265 missense probably damaging 1.00
R1302:Gle1 UTSW 2 29952552 splice site probably null
R2184:Gle1 UTSW 2 29949018 missense probably damaging 1.00
R2213:Gle1 UTSW 2 29949301 missense probably damaging 0.97
R4151:Gle1 UTSW 2 29944044 missense probably damaging 1.00
R4172:Gle1 UTSW 2 29938526 missense probably benign
R4732:Gle1 UTSW 2 29940232 missense probably damaging 0.96
R4733:Gle1 UTSW 2 29940232 missense probably damaging 0.96
R4817:Gle1 UTSW 2 29936211 missense probably benign 0.00
R4824:Gle1 UTSW 2 29940203 missense possibly damaging 0.82
R4869:Gle1 UTSW 2 29936020 missense possibly damaging 0.69
R4909:Gle1 UTSW 2 29936080 missense probably benign 0.01
R5036:Gle1 UTSW 2 29936211 missense probably benign 0.00
R5298:Gle1 UTSW 2 29948943 missense probably benign 0.02
R5903:Gle1 UTSW 2 29940281 missense probably benign 0.00
R6345:Gle1 UTSW 2 29936115 missense probably benign 0.00
R6529:Gle1 UTSW 2 29935527 missense possibly damaging 0.56
R7144:Gle1 UTSW 2 29943793 missense probably damaging 1.00
R7984:Gle1 UTSW 2 29938576 missense probably damaging 0.99
R8154:Gle1 UTSW 2 29938607 critical splice donor site probably null
R8203:Gle1 UTSW 2 29935510 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGGCCTTCAGCTGTTAAG -3'
(R):5'- AAGCCTTACCTGGGTTCCATTTG -3'

Sequencing Primer
(F):5'- CAGATTTCTGAGTTCGAGACCAGC -3'
(R):5'- CCATTTGGTGATGAGGGTGAC -3'
Posted On2015-12-29