Mutagenetix > Incidental Mutations

Incidental Mutation 'R4775:Nelfcd'

367826

Institutional Source

Beutler Lab

Gene Symbol

Nelfcd

Ensembl Gene

ENSMUSG00000016253

Gene Name

negative elongation factor complex member C/D, Th1l

Synonyms

trihydrophobin 1, Th1l, 2410003I03Rik

MMRRC Submission

041991-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.945) question?

Stock #

R4775 (G1)

Quality Score

129

Status

Not validated

Chromosome

Chromosomal Location

174415804-174427502 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 174426576 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Glycine at position 520 (C520G)

Ref Sequence

ENSEMBL: ENSMUSP00000104703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016397] [ENSMUST00000016400] [ENSMUST00000109075]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000016397
AA Change: C536G

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000016397
Gene: ENSMUSG00000016253
AA Change: C536G

Domain	Start	End	E-Value	Type
Pfam:TH1	11	604	6.5e-276	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000016400

SMART Domains

Protein: ENSMUSP00000016400
Gene: ENSMUSG00000016256

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pept_C1	64	301	5.46e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109075
AA Change: C520G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000104703
Gene: ENSMUSG00000016253
AA Change: C520G

Domain	Start	End	E-Value	Type
Pfam:TH1	10	590	5.6e-303	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129716

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137986

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139390

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143683

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NELF complex of proteins interacts with the DSIF protein complex to repress transcriptional elongation by RNA polymerase II. The protein encoded by this gene is an essential part of the NELF complex. Alternative translation initiation site usage results in the formation of two isoforms with different N-termini. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,243,339	Y426C	probably damaging	Het
Adam7	A	G	14: 68,507,912	I621T	probably benign	Het
Adamts1	A	T	16: 85,800,390	Y260*	probably null	Het
Adgrf1	C	T	17: 43,311,163	L764F	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Atp9b	A	G	18: 80,765,769		probably null	Het
BC067074	A	T	13: 113,317,695	I92F	possibly damaging	Het
C5ar2	A	C	7: 16,237,615	L129R	probably damaging	Het
Ccdc174	G	A	6: 91,890,894		probably null	Het
Cidec	T	C	6: 113,434,734	M1V	probably null	Het
Clec16a	G	T	16: 10,638,914	R663L	probably damaging	Het
Col25a1	T	C	3: 130,182,819	C118R	possibly damaging	Het
Cox6b2	A	G	7: 4,752,075	C67R	probably damaging	Het
Cwf19l2	A	G	9: 3,430,973	Y435C	probably benign	Het
Dapk1	T	A	13: 60,749,342	S792T	probably benign	Het
Dis3l	T	A	9: 64,330,908	N101Y	probably benign	Het
Dsg4	A	G	18: 20,471,127	T884A	possibly damaging	Het
Dvl1	T	C	4: 155,858,127	W617R	probably benign	Het
Eml5	A	G	12: 98,802,307	V1503A	probably benign	Het
Engase	A	T	11: 118,482,671	D280V	probably benign	Het
F11r	T	C	1: 171,461,641	S224P	probably damaging	Het
Fanca	A	G	8: 123,296,306	V564A	probably damaging	Het
Foxj2	G	T	6: 122,833,271	Q196H	probably benign	Het
Gle1	T	C	2: 29,936,061	W51R	possibly damaging	Het
Gm94	A	G	18: 43,792,771		probably null	Het
Gm9830	A	T	9: 44,464,424		noncoding transcript	Het
Gpaa1	T	A	15: 76,334,691		probably null	Het
Grin1	C	T	2: 25,292,463	A929T	possibly damaging	Het
Grm7	T	A	6: 110,914,371	D188E	probably damaging	Het
Gtf2ird2	T	C	5: 134,214,128	F395L	probably benign	Het
Lipo1	C	A	19: 33,780,395	G225C	probably damaging	Het
Lonrf2	T	A	1: 38,818,059		probably null	Het
Marveld2	A	G	13: 100,616,795		probably benign	Het
Mpl	A	G	4: 118,448,580	L416P	probably damaging	Het
Mppe1	A	G	18: 67,226,859	L312P	possibly damaging	Het
Mpzl3	T	A	9: 45,066,432	S113T	probably damaging	Het
Mylk3	G	A	8: 85,359,060	Q149*	probably null	Het
Myt1	T	A	2: 181,822,677	I968N	probably damaging	Het
Ndc80	A	G	17: 71,514,270	Y228H	probably damaging	Het
Nfrkb	C	A	9: 31,419,049	T1199K	possibly damaging	Het
Nipa2	A	G	7: 55,935,863	I109T	probably benign	Het
Nlrp4e	A	G	7: 23,343,100	T804A	probably benign	Het
Nsf	A	T	11: 103,872,593	I395K	possibly damaging	Het
Nt5c1b	G	A	12: 10,375,449	V331I	probably damaging	Het
Olfr389	A	G	11: 73,776,551	Y259H	probably damaging	Het
Olfr61	A	T	7: 140,637,916	I72F	probably damaging	Het
Pask	T	C	1: 93,337,524	D3G	probably damaging	Het
Pglyrp3	T	C	3: 92,025,730	V110A	possibly damaging	Het
Ppp4r3a	C	T	12: 101,053,566	V377M	probably damaging	Het
Prr12	A	G	7: 45,051,325		probably benign	Het
Ptdss1	G	A	13: 66,987,858		probably null	Het
Qser1	A	G	2: 104,789,901	S189P	probably damaging	Het
Rph3a	T	A	5: 120,954,488	Y350F	probably benign	Het
Skint4	A	T	4: 112,136,064	H328L	probably damaging	Het
Smyd4	G	A	11: 75,391,192	C497Y	probably damaging	Het
Stk11ip	T	C	1: 75,533,853	W864R	possibly damaging	Het
Stkld1	T	A	2: 26,951,745	V543E	probably damaging	Het
Taok2	A	G	7: 126,870,768	S963P	probably damaging	Het
Tars2	A	G	3: 95,746,647	L354P	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tpcn2	A	G	7: 145,267,342	L325P	probably damaging	Het
Trappc3l	C	G	10: 34,098,811	H96Q	probably benign	Het
Trim66	A	T	7: 109,457,589	Y1120*	probably null	Het
Trio	G	A	15: 27,881,342	Q548*	probably null	Het
Wipf2	T	A	11: 98,890,732	D32E	probably benign	Het

Other mutations in Nelfcd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01999:Nelfcd	APN	2	174423515	splice site	probably benign
IGL02175:Nelfcd	APN	2	174420382	missense	probably benign	0.01
IGL02955:Nelfcd	APN	2	174422598	missense	probably damaging	0.98
IGL03193:Nelfcd	APN	2	174426832	missense	possibly damaging	0.87
IGL03194:Nelfcd	APN	2	174426832	missense	possibly damaging	0.87
IGL03203:Nelfcd	APN	2	174426832	missense	possibly damaging	0.87
IGL03217:Nelfcd	APN	2	174426832	missense	possibly damaging	0.87
IGL03237:Nelfcd	APN	2	174426832	missense	possibly damaging	0.87
IGL03273:Nelfcd	APN	2	174426832	missense	possibly damaging	0.87
IGL03278:Nelfcd	APN	2	174426832	missense	possibly damaging	0.87
IGL03289:Nelfcd	APN	2	174426832	missense	possibly damaging	0.87
IGL03365:Nelfcd	APN	2	174426832	missense	possibly damaging	0.87
IGL03398:Nelfcd	APN	2	174426832	missense	possibly damaging	0.87
IGL03405:Nelfcd	APN	2	174426832	missense	possibly damaging	0.87
IGL03407:Nelfcd	APN	2	174426832	missense	possibly damaging	0.87
R0593:Nelfcd	UTSW	2	174423430	missense	probably benign	0.00
R0751:Nelfcd	UTSW	2	174423014	missense	probably benign	0.03
R1852:Nelfcd	UTSW	2	174423978	splice site	probably null
R2040:Nelfcd	UTSW	2	174420082	missense	probably damaging	1.00
R3606:Nelfcd	UTSW	2	174426544	missense	probably benign	0.10
R3716:Nelfcd	UTSW	2	174423005	missense	possibly damaging	0.51
R4235:Nelfcd	UTSW	2	174427048	missense	probably damaging	1.00
R4607:Nelfcd	UTSW	2	174423162	missense	probably benign	0.01
R5104:Nelfcd	UTSW	2	174426366	missense	probably benign	0.10
R5859:Nelfcd	UTSW	2	174427063	makesense	probably null
R6025:Nelfcd	UTSW	2	174426818	missense	probably damaging	1.00
R6104:Nelfcd	UTSW	2	174423457	missense	probably damaging	0.99
R6280:Nelfcd	UTSW	2	174415946	missense	probably benign
R7249:Nelfcd	UTSW	2	174423206	critical splice donor site	probably null
R7382:Nelfcd	UTSW	2	174423383	missense	probably benign	0.00
R7532:Nelfcd	UTSW	2	174426396	missense	probably damaging	1.00
R7545:Nelfcd	UTSW	2	174423978	splice site	probably null
R7766:Nelfcd	UTSW	2	174426832	missense	possibly damaging	0.87
Z1088:Nelfcd	UTSW	2	174426494	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TTGAGACAGAGCACTCCCAG -3'
(R):5'- GACCGCACTCCATAATAGTCAGG -3'

Sequencing Primer
(F):5'- ACTCCCAGCTAGACGTGATG -3'
(R):5'- CACTCCATAATAGTCAGGGAGGTGTG -3'

Posted On

2015-12-29