Mutagenetix > Incidental Mutation

Incidental Mutation 'R4775:Trim66'

367846

Institutional Source

Beutler Lab

Gene Symbol

Trim66

Ensembl Gene

ENSMUSG00000031026

Gene Name

tripartite motif-containing 66

Synonyms

Tif1d, D7H11orf29

MMRRC Submission

041991-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.177) question?

Stock #

R4775 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109449006-109508134 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 109457589 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1120 (Y1120*)

Ref Sequence

ENSEMBL: ENSMUSP00000102352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]

AlphaFold

Q924W6

Predicted Effect

probably null
Transcript: ENSMUST00000033339
AA Change: Y1018*

SMART Domains

Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026
AA Change: Y1018*

Domain	Start	End	E-Value	Type
PHD	4	69	7.77e0	SMART
BBC	108	234	1.61e-39	SMART
low complexity region	318	333	N/A	INTRINSIC
low complexity region	452	486	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
PHD	998	1041	4.09e-10	SMART
BROMO	1069	1175	8.22e-27	SMART
low complexity region	1185	1199	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106739
AA Change: Y1018*

SMART Domains

Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026
AA Change: Y1018*

Domain	Start	End	E-Value	Type
PHD	4	69	7.77e0	SMART
BBC	108	234	1.61e-39	SMART
low complexity region	318	333	N/A	INTRINSIC
low complexity region	452	486	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
PHD	998	1041	4.09e-10	SMART
BROMO	1069	1175	8.22e-27	SMART
low complexity region	1185	1199	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106741
AA Change: Y1120*

SMART Domains

Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: Y1120*

Domain	Start	End	E-Value	Type
RING	28	78	2.38e-2	SMART
BBOX	102	140	1.48e0	SMART
PHD	106	171	7.77e0	SMART
RING	107	170	4.38e0	SMART
BBOX	162	203	4.21e-3	SMART
BBC	210	336	1.61e-39	SMART
low complexity region	420	435	N/A	INTRINSIC
low complexity region	554	588	N/A	INTRINSIC
low complexity region	619	632	N/A	INTRINSIC
low complexity region	670	683	N/A	INTRINSIC
PHD	1100	1143	4.09e-10	SMART
BROMO	1171	1277	8.22e-27	SMART
low complexity region	1287	1301	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,243,339	Y426C	probably damaging	Het
Adam7	A	G	14: 68,507,912	I621T	probably benign	Het
Adamts1	A	T	16: 85,800,390	Y260*	probably null	Het
Adgrf1	C	T	17: 43,311,163	L764F	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Atp9b	A	G	18: 80,765,769		probably null	Het
BC067074	A	T	13: 113,317,695	I92F	possibly damaging	Het
C5ar2	A	C	7: 16,237,615	L129R	probably damaging	Het
Ccdc174	G	A	6: 91,890,894		probably null	Het
Cidec	T	C	6: 113,434,734	M1V	probably null	Het
Clec16a	G	T	16: 10,638,914	R663L	probably damaging	Het
Col25a1	T	C	3: 130,182,819	C118R	possibly damaging	Het
Cox6b2	A	G	7: 4,752,075	C67R	probably damaging	Het
Cwf19l2	A	G	9: 3,430,973	Y435C	probably benign	Het
Dapk1	T	A	13: 60,749,342	S792T	probably benign	Het
Dis3l	T	A	9: 64,330,908	N101Y	probably benign	Het
Dsg4	A	G	18: 20,471,127	T884A	possibly damaging	Het
Dvl1	T	C	4: 155,858,127	W617R	probably benign	Het
Eml5	A	G	12: 98,802,307	V1503A	probably benign	Het
Engase	A	T	11: 118,482,671	D280V	probably benign	Het
F11r	T	C	1: 171,461,641	S224P	probably damaging	Het
Fanca	A	G	8: 123,296,306	V564A	probably damaging	Het
Foxj2	G	T	6: 122,833,271	Q196H	probably benign	Het
Gle1	T	C	2: 29,936,061	W51R	possibly damaging	Het
Gm94	A	G	18: 43,792,771		probably null	Het
Gm9830	A	T	9: 44,464,424		noncoding transcript	Het
Gpaa1	T	A	15: 76,334,691		probably null	Het
Grin1	C	T	2: 25,292,463	A929T	possibly damaging	Het
Grm7	T	A	6: 110,914,371	D188E	probably damaging	Het
Gtf2ird2	T	C	5: 134,214,128	F395L	probably benign	Het
Lipo1	C	A	19: 33,780,395	G225C	probably damaging	Het
Lonrf2	T	A	1: 38,818,059		probably null	Het
Marveld2	A	G	13: 100,616,795		probably benign	Het
Mpl	A	G	4: 118,448,580	L416P	probably damaging	Het
Mppe1	A	G	18: 67,226,859	L312P	possibly damaging	Het
Mpzl3	T	A	9: 45,066,432	S113T	probably damaging	Het
Mylk3	G	A	8: 85,359,060	Q149*	probably null	Het
Myt1	T	A	2: 181,822,677	I968N	probably damaging	Het
Ndc80	A	G	17: 71,514,270	Y228H	probably damaging	Het
Nelfcd	T	G	2: 174,426,576	C520G	probably damaging	Het
Nfrkb	C	A	9: 31,419,049	T1199K	possibly damaging	Het
Nipa2	A	G	7: 55,935,863	I109T	probably benign	Het
Nlrp4e	A	G	7: 23,343,100	T804A	probably benign	Het
Nsf	A	T	11: 103,872,593	I395K	possibly damaging	Het
Nt5c1b	G	A	12: 10,375,449	V331I	probably damaging	Het
Olfr389	A	G	11: 73,776,551	Y259H	probably damaging	Het
Olfr61	A	T	7: 140,637,916	I72F	probably damaging	Het
Pask	T	C	1: 93,337,524	D3G	probably damaging	Het
Pglyrp3	T	C	3: 92,025,730	V110A	possibly damaging	Het
Ppp4r3a	C	T	12: 101,053,566	V377M	probably damaging	Het
Prr12	A	G	7: 45,051,325		probably benign	Het
Ptdss1	G	A	13: 66,987,858		probably null	Het
Qser1	A	G	2: 104,789,901	S189P	probably damaging	Het
Rph3a	T	A	5: 120,954,488	Y350F	probably benign	Het
Skint4	A	T	4: 112,136,064	H328L	probably damaging	Het
Smyd4	G	A	11: 75,391,192	C497Y	probably damaging	Het
Stk11ip	T	C	1: 75,533,853	W864R	possibly damaging	Het
Stkld1	T	A	2: 26,951,745	V543E	probably damaging	Het
Taok2	A	G	7: 126,870,768	S963P	probably damaging	Het
Tars2	A	G	3: 95,746,647	L354P	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tpcn2	A	G	7: 145,267,342	L325P	probably damaging	Het
Trappc3l	C	G	10: 34,098,811	H96Q	probably benign	Het
Trio	G	A	15: 27,881,342	Q548*	probably null	Het
Wipf2	T	A	11: 98,890,732	D32E	probably benign	Het

Other mutations in Trim66

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01539:Trim66	APN	7	109455066	missense	probably benign	0.02
IGL01758:Trim66	APN	7	109486045	critical splice donor site	probably null
IGL01982:Trim66	APN	7	109458763	missense	probably benign	0.00
IGL01983:Trim66	APN	7	109458251	nonsense	probably null
IGL02149:Trim66	APN	7	109460902	missense	possibly damaging	0.66
IGL02392:Trim66	APN	7	109460274	missense	probably benign	0.01
IGL02483:Trim66	APN	7	109477630	splice site	probably benign
IGL02832:Trim66	APN	7	109460497	missense	probably damaging	1.00
IGL02945:Trim66	APN	7	109460176	nonsense	probably null
IGL03085:Trim66	APN	7	109458745	missense	probably benign	0.17
PIT1430001:Trim66	UTSW	7	109475247	missense	probably damaging	0.99
R0326:Trim66	UTSW	7	109460172	missense	probably benign	0.00
R0358:Trim66	UTSW	7	109460176	nonsense	probably null
R0401:Trim66	UTSW	7	109475264	missense	probably damaging	0.98
R0470:Trim66	UTSW	7	109457542	splice site	probably benign
R0568:Trim66	UTSW	7	109460695	missense	probably benign	0.00
R0669:Trim66	UTSW	7	109454992	intron	probably benign
R0980:Trim66	UTSW	7	109455670	missense	probably damaging	1.00
R1015:Trim66	UTSW	7	109455233	missense	probably damaging	1.00
R1078:Trim66	UTSW	7	109472319	missense	probably damaging	1.00
R1099:Trim66	UTSW	7	109475454	missense	probably benign	0.34
R1181:Trim66	UTSW	7	109484577	critical splice donor site	probably null
R1497:Trim66	UTSW	7	109484619	missense	probably benign	0.00
R1583:Trim66	UTSW	7	109455080	missense	probably damaging	1.00
R1843:Trim66	UTSW	7	109475839	missense	probably damaging	0.99
R1998:Trim66	UTSW	7	109484577	critical splice donor site	probably null
R2016:Trim66	UTSW	7	109472232	critical splice donor site	probably null
R2143:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R2144:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R2145:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R3945:Trim66	UTSW	7	109472268	missense	possibly damaging	0.94
R4012:Trim66	UTSW	7	109458131	missense	probably damaging	0.98
R4464:Trim66	UTSW	7	109477690	missense	possibly damaging	0.51
R4473:Trim66	UTSW	7	109481995	missense	probably damaging	1.00
R4729:Trim66	UTSW	7	109456060	critical splice donor site	probably null
R4730:Trim66	UTSW	7	109483069	missense	probably damaging	1.00
R4819:Trim66	UTSW	7	109457586	missense	probably damaging	1.00
R5269:Trim66	UTSW	7	109457590	missense	probably benign	0.00
R5557:Trim66	UTSW	7	109483737	missense	probably benign	0.06
R5832:Trim66	UTSW	7	109455202	missense	probably damaging	1.00
R6220:Trim66	UTSW	7	109483093	missense	probably damaging	0.97
R6243:Trim66	UTSW	7	109460274	missense	probably benign	0.01
R6374:Trim66	UTSW	7	109486062	missense	probably benign
R6450:Trim66	UTSW	7	109460738	missense	probably benign	0.09
R6543:Trim66	UTSW	7	109475879	missense	probably benign	0.01
R6788:Trim66	UTSW	7	109477754	missense	probably damaging	1.00
R6842:Trim66	UTSW	7	109460776	missense	probably benign	0.00
R7169:Trim66	UTSW	7	109455121	missense	probably benign	0.25
R7257:Trim66	UTSW	7	109460244	missense	probably damaging	1.00
R7328:Trim66	UTSW	7	109457751	missense	probably damaging	0.99
R7616:Trim66	UTSW	7	109483749	missense	probably damaging	0.99
R8423:Trim66	UTSW	7	109475392	missense	possibly damaging	0.77
R8855:Trim66	UTSW	7	109481981	missense	probably damaging	1.00
R9130:Trim66	UTSW	7	109477689	missense	possibly damaging	0.90
R9137:Trim66	UTSW	7	109475123	missense	probably damaging	0.99
R9640:Trim66	UTSW	7	109475618	missense	probably damaging	1.00
RF013:Trim66	UTSW	7	109460753	missense	probably damaging	0.99
RF024:Trim66	UTSW	7	109460740	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- AAGCTAGGGCCAGCTATGAG -3'
(R):5'- ACTGTCACATCTCTGACTGGG -3'

Sequencing Primer
(F):5'- GGCAAATCTGTTATAGAAGCCCTG -3'
(R):5'- ACATCTCTGACTGGGCAGCAG -3'

Posted On

2015-12-29