Mutagenetix > Incidental Mutations

Incidental Mutation 'R4775:Olfr61'

367848

Institutional Source

Beutler Lab

Gene Symbol

Olfr61

Ensembl Gene

ENSMUSG00000096069

Gene Name

olfactory receptor 61

Synonyms

MOR253-1, IH7, GA_x6K02T2PBJ9-42783826-42784758

MMRRC Submission

041991-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R4775 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

140628970-140638798 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 140637916 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 72 (I72F)

Ref Sequence

ENSEMBL: ENSMUSP00000147924 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084455] [ENSMUST00000210241] [ENSMUST00000210373] [ENSMUST00000211685]

Predicted Effect

probably damaging
Transcript: ENSMUST00000084455
AA Change: I72F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000081493
Gene: ENSMUSG00000096069
AA Change: I72F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	32	308	3.3e-49	PFAM
Pfam:7TM_GPCR_Srsx	36	175	1.3e-8	PFAM
Pfam:7tm_1	42	291	3.6e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000210241
AA Change: I72F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000210373
AA Change: I13F

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211685
AA Change: I72F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,243,339	Y426C	probably damaging	Het
Adam7	A	G	14: 68,507,912	I621T	probably benign	Het
Adamts1	A	T	16: 85,800,390	Y260*	probably null	Het
Adgrf1	C	T	17: 43,311,163	L764F	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Atp9b	A	G	18: 80,765,769		probably null	Het
BC067074	A	T	13: 113,317,695	I92F	possibly damaging	Het
C5ar2	A	C	7: 16,237,615	L129R	probably damaging	Het
Ccdc174	G	A	6: 91,890,894		probably null	Het
Cidec	T	C	6: 113,434,734	M1V	probably null	Het
Clec16a	G	T	16: 10,638,914	R663L	probably damaging	Het
Col25a1	T	C	3: 130,182,819	C118R	possibly damaging	Het
Cox6b2	A	G	7: 4,752,075	C67R	probably damaging	Het
Cwf19l2	A	G	9: 3,430,973	Y435C	probably benign	Het
Dapk1	T	A	13: 60,749,342	S792T	probably benign	Het
Dis3l	T	A	9: 64,330,908	N101Y	probably benign	Het
Dsg4	A	G	18: 20,471,127	T884A	possibly damaging	Het
Dvl1	T	C	4: 155,858,127	W617R	probably benign	Het
Eml5	A	G	12: 98,802,307	V1503A	probably benign	Het
Engase	A	T	11: 118,482,671	D280V	probably benign	Het
F11r	T	C	1: 171,461,641	S224P	probably damaging	Het
Fanca	A	G	8: 123,296,306	V564A	probably damaging	Het
Foxj2	G	T	6: 122,833,271	Q196H	probably benign	Het
Gle1	T	C	2: 29,936,061	W51R	possibly damaging	Het
Gm94	A	G	18: 43,792,771		probably null	Het
Gm9830	A	T	9: 44,464,424		noncoding transcript	Het
Gpaa1	T	A	15: 76,334,691		probably null	Het
Grin1	C	T	2: 25,292,463	A929T	possibly damaging	Het
Grm7	T	A	6: 110,914,371	D188E	probably damaging	Het
Gtf2ird2	T	C	5: 134,214,128	F395L	probably benign	Het
Lipo1	C	A	19: 33,780,395	G225C	probably damaging	Het
Lonrf2	T	A	1: 38,818,059		probably null	Het
Marveld2	A	G	13: 100,616,795		probably benign	Het
Mpl	A	G	4: 118,448,580	L416P	probably damaging	Het
Mppe1	A	G	18: 67,226,859	L312P	possibly damaging	Het
Mpzl3	T	A	9: 45,066,432	S113T	probably damaging	Het
Mylk3	G	A	8: 85,359,060	Q149*	probably null	Het
Myt1	T	A	2: 181,822,677	I968N	probably damaging	Het
Ndc80	A	G	17: 71,514,270	Y228H	probably damaging	Het
Nelfcd	T	G	2: 174,426,576	C520G	probably damaging	Het
Nfrkb	C	A	9: 31,419,049	T1199K	possibly damaging	Het
Nipa2	A	G	7: 55,935,863	I109T	probably benign	Het
Nlrp4e	A	G	7: 23,343,100	T804A	probably benign	Het
Nsf	A	T	11: 103,872,593	I395K	possibly damaging	Het
Nt5c1b	G	A	12: 10,375,449	V331I	probably damaging	Het
Olfr389	A	G	11: 73,776,551	Y259H	probably damaging	Het
Pask	T	C	1: 93,337,524	D3G	probably damaging	Het
Pglyrp3	T	C	3: 92,025,730	V110A	possibly damaging	Het
Ppp4r3a	C	T	12: 101,053,566	V377M	probably damaging	Het
Prr12	A	G	7: 45,051,325		probably benign	Het
Ptdss1	G	A	13: 66,987,858		probably null	Het
Qser1	A	G	2: 104,789,901	S189P	probably damaging	Het
Rph3a	T	A	5: 120,954,488	Y350F	probably benign	Het
Skint4	A	T	4: 112,136,064	H328L	probably damaging	Het
Smyd4	G	A	11: 75,391,192	C497Y	probably damaging	Het
Stk11ip	T	C	1: 75,533,853	W864R	possibly damaging	Het
Stkld1	T	A	2: 26,951,745	V543E	probably damaging	Het
Taok2	A	G	7: 126,870,768	S963P	probably damaging	Het
Tars2	A	G	3: 95,746,647	L354P	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tpcn2	A	G	7: 145,267,342	L325P	probably damaging	Het
Trappc3l	C	G	10: 34,098,811	H96Q	probably benign	Het
Trim66	A	T	7: 109,457,589	Y1120*	probably null	Het
Trio	G	A	15: 27,881,342	Q548*	probably null	Het
Wipf2	T	A	11: 98,890,732	D32E	probably benign	Het

Other mutations in Olfr61

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00958:Olfr61	APN	7	140638256	missense	probably damaging	1.00
IGL01837:Olfr61	APN	7	140638211	missense	probably damaging	1.00
IGL02349:Olfr61	APN	7	140638471	missense	probably benign	0.00
IGL02713:Olfr61	APN	7	140637916	missense	probably damaging	0.98
IGL02982:Olfr61	APN	7	140637952	missense	probably benign	0.06
IGL03205:Olfr61	APN	7	140638160	missense	possibly damaging	0.90
R1477:Olfr61	UTSW	7	140638442	missense	possibly damaging	0.94
R1564:Olfr61	UTSW	7	140638054	missense	probably benign	0.21
R1900:Olfr61	UTSW	7	140638592	missense	probably damaging	0.99
R2149:Olfr61	UTSW	7	140638052	missense	probably damaging	0.99
R2504:Olfr61	UTSW	7	140638484	missense	probably benign	0.01
R2887:Olfr61	UTSW	7	140638225	missense	probably damaging	1.00
R3787:Olfr61	UTSW	7	140637835	missense	probably benign	0.01
R4628:Olfr61	UTSW	7	140638384	missense	probably benign	0.04
R5805:Olfr61	UTSW	7	140638471	missense	probably benign	0.00
R6019:Olfr61	UTSW	7	140638012	missense	probably benign	0.03
R6244:Olfr61	UTSW	7	140638433	missense	probably damaging	1.00
R7303:Olfr61	UTSW	7	140638354	missense	probably damaging	1.00
R7505:Olfr61	UTSW	7	140638052	missense	probably damaging	1.00
R7783:Olfr61	UTSW	7	140637724	missense	possibly damaging	0.86
R7936:Olfr61	UTSW	7	140637739	missense	probably damaging	1.00
Z1088:Olfr61	UTSW	7	140638220	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTCCCAACCAGACAGAAGTG -3'
(R):5'- ATTCTAGAGCTGTAGTGCAGGG -3'

Sequencing Primer
(F):5'- CCAGACAGAAGTGACAGAGTTTATAC -3'
(R):5'- GGAAAGCAGATGGCCACATAGC -3'

Posted On

2015-12-29