Incidental Mutation 'R4775:Mylk3'
List |< first << previous [record 37 of 66] next >> last >|
ID367850
Institutional Source Beutler Lab
Gene Symbol Mylk3
Ensembl Gene ENSMUSG00000031698
Gene Namemyosin light chain kinase 3
Synonyms
MMRRC Submission 041991-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R4775 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location85324303-85386345 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 85359060 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 149 (Q149*)
Ref Sequence ENSEMBL: ENSMUSP00000113389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034133] [ENSMUST00000121972] [ENSMUST00000122452] [ENSMUST00000137290]
Predicted Effect probably null
Transcript: ENSMUST00000034133
AA Change: Q282*
SMART Domains Protein: ENSMUSP00000034133
Gene: ENSMUSG00000031698
AA Change: Q282*

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
S_TKc 491 746 6.93e-91 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121972
AA Change: Q219*
SMART Domains Protein: ENSMUSP00000113960
Gene: ENSMUSG00000031698
AA Change: Q219*

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
S_TKc 428 683 6.93e-91 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122452
AA Change: Q149*
SMART Domains Protein: ENSMUSP00000113389
Gene: ENSMUSG00000031698
AA Change: Q149*

DomainStartEndE-ValueType
low complexity region 171 183 N/A INTRINSIC
S_TKc 358 613 6.93e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138825
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylation of cardiac myosin heavy chains (see MYH7B, MIM 609928) and light chains (see MYL2, MIM 160781) by a kinase, such as MYLK3, potentiates the force and rate of cross-bridge recruitment in cardiac myocytes (Chan et al., 2008 [PubMed 18202317]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cardiac hypertrophy, reduced cardiac function and increased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,243,339 Y426C probably damaging Het
Adam7 A G 14: 68,507,912 I621T probably benign Het
Adamts1 A T 16: 85,800,390 Y260* probably null Het
Adgrf1 C T 17: 43,311,163 L764F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Atp9b A G 18: 80,765,769 probably null Het
BC067074 A T 13: 113,317,695 I92F possibly damaging Het
C5ar2 A C 7: 16,237,615 L129R probably damaging Het
Ccdc174 G A 6: 91,890,894 probably null Het
Cidec T C 6: 113,434,734 M1V probably null Het
Clec16a G T 16: 10,638,914 R663L probably damaging Het
Col25a1 T C 3: 130,182,819 C118R possibly damaging Het
Cox6b2 A G 7: 4,752,075 C67R probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
Dapk1 T A 13: 60,749,342 S792T probably benign Het
Dis3l T A 9: 64,330,908 N101Y probably benign Het
Dsg4 A G 18: 20,471,127 T884A possibly damaging Het
Dvl1 T C 4: 155,858,127 W617R probably benign Het
Eml5 A G 12: 98,802,307 V1503A probably benign Het
Engase A T 11: 118,482,671 D280V probably benign Het
F11r T C 1: 171,461,641 S224P probably damaging Het
Fanca A G 8: 123,296,306 V564A probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gle1 T C 2: 29,936,061 W51R possibly damaging Het
Gm94 A G 18: 43,792,771 probably null Het
Gm9830 A T 9: 44,464,424 noncoding transcript Het
Gpaa1 T A 15: 76,334,691 probably null Het
Grin1 C T 2: 25,292,463 A929T possibly damaging Het
Grm7 T A 6: 110,914,371 D188E probably damaging Het
Gtf2ird2 T C 5: 134,214,128 F395L probably benign Het
Lipo1 C A 19: 33,780,395 G225C probably damaging Het
Lonrf2 T A 1: 38,818,059 probably null Het
Marveld2 A G 13: 100,616,795 probably benign Het
Mpl A G 4: 118,448,580 L416P probably damaging Het
Mppe1 A G 18: 67,226,859 L312P possibly damaging Het
Mpzl3 T A 9: 45,066,432 S113T probably damaging Het
Myt1 T A 2: 181,822,677 I968N probably damaging Het
Ndc80 A G 17: 71,514,270 Y228H probably damaging Het
Nelfcd T G 2: 174,426,576 C520G probably damaging Het
Nfrkb C A 9: 31,419,049 T1199K possibly damaging Het
Nipa2 A G 7: 55,935,863 I109T probably benign Het
Nlrp4e A G 7: 23,343,100 T804A probably benign Het
Nsf A T 11: 103,872,593 I395K possibly damaging Het
Nt5c1b G A 12: 10,375,449 V331I probably damaging Het
Olfr389 A G 11: 73,776,551 Y259H probably damaging Het
Olfr61 A T 7: 140,637,916 I72F probably damaging Het
Pask T C 1: 93,337,524 D3G probably damaging Het
Pglyrp3 T C 3: 92,025,730 V110A possibly damaging Het
Ppp4r3a C T 12: 101,053,566 V377M probably damaging Het
Prr12 A G 7: 45,051,325 probably benign Het
Ptdss1 G A 13: 66,987,858 probably null Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rph3a T A 5: 120,954,488 Y350F probably benign Het
Skint4 A T 4: 112,136,064 H328L probably damaging Het
Smyd4 G A 11: 75,391,192 C497Y probably damaging Het
Stk11ip T C 1: 75,533,853 W864R possibly damaging Het
Stkld1 T A 2: 26,951,745 V543E probably damaging Het
Taok2 A G 7: 126,870,768 S963P probably damaging Het
Tars2 A G 3: 95,746,647 L354P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn2 A G 7: 145,267,342 L325P probably damaging Het
Trappc3l C G 10: 34,098,811 H96Q probably benign Het
Trim66 A T 7: 109,457,589 Y1120* probably null Het
Trio G A 15: 27,881,342 Q548* probably null Het
Wipf2 T A 11: 98,890,732 D32E probably benign Het
Other mutations in Mylk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Mylk3 APN 8 85355526 nonsense probably null
IGL01088:Mylk3 APN 8 85351957 splice site probably null
IGL01431:Mylk3 APN 8 85336401 missense probably damaging 1.00
IGL01488:Mylk3 APN 8 85352027 missense probably damaging 1.00
IGL01550:Mylk3 APN 8 85365089 missense probably damaging 1.00
IGL01786:Mylk3 APN 8 85359317 missense probably benign 0.27
IGL01877:Mylk3 APN 8 85359042 missense possibly damaging 0.66
IGL01995:Mylk3 APN 8 85359261 missense possibly damaging 0.83
IGL02003:Mylk3 APN 8 85359098 missense probably benign
IGL02251:Mylk3 APN 8 85355176 missense probably benign 0.04
IGL02252:Mylk3 APN 8 85355476 missense probably benign 0.04
IGL02341:Mylk3 APN 8 85351972 missense probably damaging 1.00
IGL02352:Mylk3 APN 8 85355302 missense probably benign 0.00
IGL02359:Mylk3 APN 8 85355302 missense probably benign 0.00
IGL03000:Mylk3 APN 8 85359177 missense probably damaging 0.97
IGL03185:Mylk3 APN 8 85327204 missense probably damaging 0.97
IGL03404:Mylk3 APN 8 85342681 missense probably damaging 1.00
R0005:Mylk3 UTSW 8 85327203 missense possibly damaging 0.93
R0219:Mylk3 UTSW 8 85355244 missense probably damaging 0.99
R0324:Mylk3 UTSW 8 85352906 missense probably damaging 0.98
R0402:Mylk3 UTSW 8 85352910 missense probably damaging 1.00
R0667:Mylk3 UTSW 8 85355165 critical splice donor site probably null
R1711:Mylk3 UTSW 8 85364831 missense probably damaging 1.00
R1857:Mylk3 UTSW 8 85328594 missense probably damaging 0.98
R1875:Mylk3 UTSW 8 85352865 missense probably damaging 1.00
R1878:Mylk3 UTSW 8 85355399 missense possibly damaging 0.82
R1916:Mylk3 UTSW 8 85327192 missense probably damaging 1.00
R3887:Mylk3 UTSW 8 85352047 missense probably damaging 1.00
R4081:Mylk3 UTSW 8 85328682 missense probably damaging 1.00
R4796:Mylk3 UTSW 8 85350385 missense probably damaging 1.00
R4974:Mylk3 UTSW 8 85364783 missense probably damaging 0.97
R5108:Mylk3 UTSW 8 85359092 missense possibly damaging 0.83
R5194:Mylk3 UTSW 8 85352866 missense probably benign 0.26
R5276:Mylk3 UTSW 8 85355442 missense probably damaging 1.00
R5296:Mylk3 UTSW 8 85355431 missense possibly damaging 0.66
R5303:Mylk3 UTSW 8 85350476 missense probably damaging 1.00
R5338:Mylk3 UTSW 8 85342721 missense probably damaging 1.00
R5957:Mylk3 UTSW 8 85328637 missense probably damaging 0.98
R6021:Mylk3 UTSW 8 85364813 missense possibly damaging 0.92
R6294:Mylk3 UTSW 8 85350383 missense probably damaging 1.00
R6305:Mylk3 UTSW 8 85350419 missense probably damaging 1.00
R6376:Mylk3 UTSW 8 85358942 missense possibly damaging 0.53
R6970:Mylk3 UTSW 8 85359263 missense probably damaging 0.97
R7081:Mylk3 UTSW 8 85364793 missense probably benign 0.10
R7170:Mylk3 UTSW 8 85350485 missense probably damaging 1.00
R7318:Mylk3 UTSW 8 85359097 missense probably benign
R7422:Mylk3 UTSW 8 85355244 missense probably benign 0.16
R7503:Mylk3 UTSW 8 85353589 missense probably benign 0.00
R7536:Mylk3 UTSW 8 85353604 missense probably benign 0.05
Z1176:Mylk3 UTSW 8 85365179
Z1177:Mylk3 UTSW 8 85359194 missense probably benign 0.14
Z1177:Mylk3 UTSW 8 85365179
Predicted Primers PCR Primer
(F):5'- ATGCTGTTAATTAGACCCACGGC -3'
(R):5'- CAATACGTCACTGAAGGGAGC -3'

Sequencing Primer
(F):5'- GTTAATTAGACCCACGGCCCAAC -3'
(R):5'- TCACTGAAGGGAGCTGACCTAAC -3'
Posted On2015-12-29