Incidental Mutation 'R4775:Mpzl3'
ID367855
Institutional Source Beutler Lab
Gene Symbol Mpzl3
Ensembl Gene ENSMUSG00000070305
Gene Namemyelin protein zero-like 3
SynonymsA530065I17Rik, 5430427F17Rik, rc
MMRRC Submission 041991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4775 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location45055186-45077436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45066432 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 113 (S113T)
Ref Sequence ENSEMBL: ENSMUSP00000110312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114663] [ENSMUST00000114664]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093856
SMART Domains Protein: ENSMUSP00000091378
Gene: ENSMUSG00000070305

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Blast:IG 38 82 5e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114663
SMART Domains Protein: ENSMUSP00000110311
Gene: ENSMUSG00000070305

DomainStartEndE-ValueType
IG 38 149 3.35e-5 SMART
Blast:IG_like 150 230 6e-26 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000114664
AA Change: S113T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110312
Gene: ENSMUSG00000070305
AA Change: S113T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IG 38 149 3.35e-5 SMART
Blast:IG_like 150 229 3e-25 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187113
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous allele have a rough coat that becomes brittle and oily with age, and display stunted growth, cyclic and progressive hair loss, hyperplastic epidermis, abnormal hair follicles, myocardial degeneration, and reduced collagen and elastin content in the skin and heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,243,339 Y426C probably damaging Het
Adam7 A G 14: 68,507,912 I621T probably benign Het
Adamts1 A T 16: 85,800,390 Y260* probably null Het
Adgrf1 C T 17: 43,311,163 L764F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Atp9b A G 18: 80,765,769 probably null Het
BC067074 A T 13: 113,317,695 I92F possibly damaging Het
C5ar2 A C 7: 16,237,615 L129R probably damaging Het
Ccdc174 G A 6: 91,890,894 probably null Het
Cidec T C 6: 113,434,734 M1V probably null Het
Clec16a G T 16: 10,638,914 R663L probably damaging Het
Col25a1 T C 3: 130,182,819 C118R possibly damaging Het
Cox6b2 A G 7: 4,752,075 C67R probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
Dapk1 T A 13: 60,749,342 S792T probably benign Het
Dis3l T A 9: 64,330,908 N101Y probably benign Het
Dsg4 A G 18: 20,471,127 T884A possibly damaging Het
Dvl1 T C 4: 155,858,127 W617R probably benign Het
Eml5 A G 12: 98,802,307 V1503A probably benign Het
Engase A T 11: 118,482,671 D280V probably benign Het
F11r T C 1: 171,461,641 S224P probably damaging Het
Fanca A G 8: 123,296,306 V564A probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gle1 T C 2: 29,936,061 W51R possibly damaging Het
Gm94 A G 18: 43,792,771 probably null Het
Gm9830 A T 9: 44,464,424 noncoding transcript Het
Gpaa1 T A 15: 76,334,691 probably null Het
Grin1 C T 2: 25,292,463 A929T possibly damaging Het
Grm7 T A 6: 110,914,371 D188E probably damaging Het
Gtf2ird2 T C 5: 134,214,128 F395L probably benign Het
Lipo1 C A 19: 33,780,395 G225C probably damaging Het
Lonrf2 T A 1: 38,818,059 probably null Het
Marveld2 A G 13: 100,616,795 probably benign Het
Mpl A G 4: 118,448,580 L416P probably damaging Het
Mppe1 A G 18: 67,226,859 L312P possibly damaging Het
Mylk3 G A 8: 85,359,060 Q149* probably null Het
Myt1 T A 2: 181,822,677 I968N probably damaging Het
Ndc80 A G 17: 71,514,270 Y228H probably damaging Het
Nelfcd T G 2: 174,426,576 C520G probably damaging Het
Nfrkb C A 9: 31,419,049 T1199K possibly damaging Het
Nipa2 A G 7: 55,935,863 I109T probably benign Het
Nlrp4e A G 7: 23,343,100 T804A probably benign Het
Nsf A T 11: 103,872,593 I395K possibly damaging Het
Nt5c1b G A 12: 10,375,449 V331I probably damaging Het
Olfr389 A G 11: 73,776,551 Y259H probably damaging Het
Olfr61 A T 7: 140,637,916 I72F probably damaging Het
Pask T C 1: 93,337,524 D3G probably damaging Het
Pglyrp3 T C 3: 92,025,730 V110A possibly damaging Het
Ppp4r3a C T 12: 101,053,566 V377M probably damaging Het
Prr12 A G 7: 45,051,325 probably benign Het
Ptdss1 G A 13: 66,987,858 probably null Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rph3a T A 5: 120,954,488 Y350F probably benign Het
Skint4 A T 4: 112,136,064 H328L probably damaging Het
Smyd4 G A 11: 75,391,192 C497Y probably damaging Het
Stk11ip T C 1: 75,533,853 W864R possibly damaging Het
Stkld1 T A 2: 26,951,745 V543E probably damaging Het
Taok2 A G 7: 126,870,768 S963P probably damaging Het
Tars2 A G 3: 95,746,647 L354P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn2 A G 7: 145,267,342 L325P probably damaging Het
Trappc3l C G 10: 34,098,811 H96Q probably benign Het
Trim66 A T 7: 109,457,589 Y1120* probably null Het
Trio G A 15: 27,881,342 Q548* probably null Het
Wipf2 T A 11: 98,890,732 D32E probably benign Het
Other mutations in Mpzl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02420:Mpzl3 APN 9 45066517 missense possibly damaging 0.95
IGL02969:Mpzl3 APN 9 45068216 missense probably benign 0.00
mausolus UTSW 9 45068252 missense probably damaging 1.00
satrap UTSW 9 45055244 start codon destroyed probably null 0.06
R0069:Mpzl3 UTSW 9 45068252 missense probably damaging 1.00
R0196:Mpzl3 UTSW 9 45062160 missense probably damaging 0.98
R0557:Mpzl3 UTSW 9 45066508 missense probably damaging 1.00
R1511:Mpzl3 UTSW 9 45066529 missense probably damaging 0.99
R4580:Mpzl3 UTSW 9 45068231 missense possibly damaging 0.94
R4825:Mpzl3 UTSW 9 45068329 missense probably benign 0.00
R4972:Mpzl3 UTSW 9 45062256 intron probably benign
R5189:Mpzl3 UTSW 9 45062110 missense possibly damaging 0.95
R5371:Mpzl3 UTSW 9 45055212 utr 5 prime probably benign
R5925:Mpzl3 UTSW 9 45062114 missense probably damaging 1.00
R7191:Mpzl3 UTSW 9 45055244 start codon destroyed probably null 0.06
R7561:Mpzl3 UTSW 9 45055312 missense probably benign
R7570:Mpzl3 UTSW 9 45070687 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAAGAGAAGCCCTTTTATACAGTTC -3'
(R):5'- TAACCTTGACACAGTGATCCTC -3'

Sequencing Primer
(F):5'- TCTTTTTAACATTGGATCTACTCGG -3'
(R):5'- CCTCTAAATCAACTGGTAAGTTCCGG -3'
Posted On2015-12-29