Incidental Mutation 'R4775:Nt5c1b'
List |< first << previous [record 45 of 66] next >> last >|
ID367866
Institutional Source Beutler Lab
Gene Symbol Nt5c1b
Ensembl Gene ENSMUSG00000020622
Gene Name5'-nucleotidase, cytosolic IB
Synonyms4921514H13Rik, CN-IB
MMRRC Submission 041991-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4775 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location10369973-10390175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10375449 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 331 (V331I)
Ref Sequence ENSEMBL: ENSMUSP00000151401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002456] [ENSMUST00000118657] [ENSMUST00000143739] [ENSMUST00000147323] [ENSMUST00000217944] [ENSMUST00000218026] [ENSMUST00000218287] [ENSMUST00000218327] [ENSMUST00000218339] [ENSMUST00000218417] [ENSMUST00000218551] [ENSMUST00000219826] [ENSMUST00000219292] [ENSMUST00000223534] [ENSMUST00000220257] [ENSMUST00000219049] [ENSMUST00000220611]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002456
AA Change: V273I

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002456
Gene: ENSMUSG00000020622
AA Change: V273I

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 570 1.6e-106 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118657
AA Change: V255I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112694
Gene: ENSMUSG00000020622
AA Change: V255I

DomainStartEndE-ValueType
low complexity region 91 103 N/A INTRINSIC
low complexity region 135 143 N/A INTRINSIC
low complexity region 225 231 N/A INTRINSIC
Pfam:5-nucleotidase 280 553 7e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143739
SMART Domains Protein: ENSMUSP00000123105
Gene: ENSMUSG00000020622

DomainStartEndE-ValueType
low complexity region 151 163 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000147323
AA Change: V273I

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117869
Gene: ENSMUSG00000020622
AA Change: V273I

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 466 4.8e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217944
AA Change: V315I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect silent
Transcript: ENSMUST00000218026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218148
Predicted Effect probably damaging
Transcript: ENSMUST00000218287
AA Change: V331I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect unknown
Transcript: ENSMUST00000218288
AA Change: V194I
Predicted Effect probably damaging
Transcript: ENSMUST00000218327
AA Change: V255I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218339
AA Change: V271I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000218417
AA Change: V315I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000218551
AA Change: V257I

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000219826
AA Change: V331I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000219292
AA Change: V273I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223534
AA Change: V257I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000220257
AA Change: V331I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect silent
Transcript: ENSMUST00000219049
Predicted Effect unknown
Transcript: ENSMUST00000219630
AA Change: V162I
Predicted Effect possibly damaging
Transcript: ENSMUST00000220611
AA Change: V257I

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic 5-prime nucleotidases, such as NT5C1B, catalyze production of adenosine, which regulates diverse physiologic processes (Sala-Newby and Newby, 2001 [PubMed 11690631]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,243,339 Y426C probably damaging Het
Adam7 A G 14: 68,507,912 I621T probably benign Het
Adamts1 A T 16: 85,800,390 Y260* probably null Het
Adgrf1 C T 17: 43,311,163 L764F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Atp9b A G 18: 80,765,769 probably null Het
BC067074 A T 13: 113,317,695 I92F possibly damaging Het
C5ar2 A C 7: 16,237,615 L129R probably damaging Het
Ccdc174 G A 6: 91,890,894 probably null Het
Cidec T C 6: 113,434,734 M1V probably null Het
Clec16a G T 16: 10,638,914 R663L probably damaging Het
Col25a1 T C 3: 130,182,819 C118R possibly damaging Het
Cox6b2 A G 7: 4,752,075 C67R probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
Dapk1 T A 13: 60,749,342 S792T probably benign Het
Dis3l T A 9: 64,330,908 N101Y probably benign Het
Dsg4 A G 18: 20,471,127 T884A possibly damaging Het
Dvl1 T C 4: 155,858,127 W617R probably benign Het
Eml5 A G 12: 98,802,307 V1503A probably benign Het
Engase A T 11: 118,482,671 D280V probably benign Het
F11r T C 1: 171,461,641 S224P probably damaging Het
Fanca A G 8: 123,296,306 V564A probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gle1 T C 2: 29,936,061 W51R possibly damaging Het
Gm94 A G 18: 43,792,771 probably null Het
Gm9830 A T 9: 44,464,424 noncoding transcript Het
Gpaa1 T A 15: 76,334,691 probably null Het
Grin1 C T 2: 25,292,463 A929T possibly damaging Het
Grm7 T A 6: 110,914,371 D188E probably damaging Het
Gtf2ird2 T C 5: 134,214,128 F395L probably benign Het
Lipo1 C A 19: 33,780,395 G225C probably damaging Het
Lonrf2 T A 1: 38,818,059 probably null Het
Marveld2 A G 13: 100,616,795 probably benign Het
Mpl A G 4: 118,448,580 L416P probably damaging Het
Mppe1 A G 18: 67,226,859 L312P possibly damaging Het
Mpzl3 T A 9: 45,066,432 S113T probably damaging Het
Mylk3 G A 8: 85,359,060 Q149* probably null Het
Myt1 T A 2: 181,822,677 I968N probably damaging Het
Ndc80 A G 17: 71,514,270 Y228H probably damaging Het
Nelfcd T G 2: 174,426,576 C520G probably damaging Het
Nfrkb C A 9: 31,419,049 T1199K possibly damaging Het
Nipa2 A G 7: 55,935,863 I109T probably benign Het
Nlrp4e A G 7: 23,343,100 T804A probably benign Het
Nsf A T 11: 103,872,593 I395K possibly damaging Het
Olfr389 A G 11: 73,776,551 Y259H probably damaging Het
Olfr61 A T 7: 140,637,916 I72F probably damaging Het
Pask T C 1: 93,337,524 D3G probably damaging Het
Pglyrp3 T C 3: 92,025,730 V110A possibly damaging Het
Ppp4r3a C T 12: 101,053,566 V377M probably damaging Het
Prr12 A G 7: 45,051,325 probably benign Het
Ptdss1 G A 13: 66,987,858 probably null Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rph3a T A 5: 120,954,488 Y350F probably benign Het
Skint4 A T 4: 112,136,064 H328L probably damaging Het
Smyd4 G A 11: 75,391,192 C497Y probably damaging Het
Stk11ip T C 1: 75,533,853 W864R possibly damaging Het
Stkld1 T A 2: 26,951,745 V543E probably damaging Het
Taok2 A G 7: 126,870,768 S963P probably damaging Het
Tars2 A G 3: 95,746,647 L354P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn2 A G 7: 145,267,342 L325P probably damaging Het
Trappc3l C G 10: 34,098,811 H96Q probably benign Het
Trim66 A T 7: 109,457,589 Y1120* probably null Het
Trio G A 15: 27,881,342 Q548* probably null Het
Wipf2 T A 11: 98,890,732 D32E probably benign Het
Other mutations in Nt5c1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Nt5c1b APN 12 10374798 missense probably benign 0.00
IGL01737:Nt5c1b APN 12 10390108 missense possibly damaging 0.93
IGL02114:Nt5c1b APN 12 10375444 missense probably damaging 1.00
IGL02131:Nt5c1b APN 12 10375491 missense possibly damaging 0.75
IGL02135:Nt5c1b APN 12 10377194 missense probably damaging 1.00
IGL02871:Nt5c1b APN 12 10381325 missense probably damaging 1.00
IGL03003:Nt5c1b APN 12 10374910 missense possibly damaging 0.90
IGL03327:Nt5c1b APN 12 10374861 nonsense probably null
R0838:Nt5c1b UTSW 12 10375071 nonsense probably null
R1340:Nt5c1b UTSW 12 10377276 missense probably damaging 1.00
R1480:Nt5c1b UTSW 12 10374886 missense probably damaging 1.00
R1599:Nt5c1b UTSW 12 10390024 missense probably damaging 1.00
R1674:Nt5c1b UTSW 12 10370055 start gained probably benign
R1691:Nt5c1b UTSW 12 10375537 missense possibly damaging 0.95
R2237:Nt5c1b UTSW 12 10375558 missense probably damaging 0.96
R2238:Nt5c1b UTSW 12 10375558 missense probably damaging 0.96
R2238:Nt5c1b UTSW 12 10390108 missense probably damaging 1.00
R2239:Nt5c1b UTSW 12 10375558 missense probably damaging 0.96
R2260:Nt5c1b UTSW 12 10374965 missense probably damaging 1.00
R2424:Nt5c1b UTSW 12 10370072 missense probably damaging 1.00
R3607:Nt5c1b UTSW 12 10377236 missense probably damaging 1.00
R4276:Nt5c1b UTSW 12 10374886 missense probably damaging 1.00
R4582:Nt5c1b UTSW 12 10390054 missense probably damaging 1.00
R4711:Nt5c1b UTSW 12 10370093 missense probably damaging 1.00
R5840:Nt5c1b UTSW 12 10377171 missense probably damaging 1.00
R5940:Nt5c1b UTSW 12 10375515 missense probably damaging 1.00
R6104:Nt5c1b UTSW 12 10372955 missense probably damaging 1.00
R6329:Nt5c1b UTSW 12 10372138 nonsense probably null
R6626:Nt5c1b UTSW 12 10374837 nonsense probably null
R6722:Nt5c1b UTSW 12 10372874 missense possibly damaging 0.48
R7424:Nt5c1b UTSW 12 10381391 splice site probably null
R7491:Nt5c1b UTSW 12 10374903 missense probably benign 0.00
R7714:Nt5c1b UTSW 12 10375472 missense probably damaging 1.00
R8008:Nt5c1b UTSW 12 10375000 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- GTATGAGAAGATCCCCAGCTGTG -3'
(R):5'- TCTTATGCAGAGTCCCTGATGG -3'

Sequencing Primer
(F):5'- TGGCTTCTGGCACCCCTAG -3'
(R):5'- CCTGATGGGAGTGAACGGC -3'
Posted On2015-12-29