Mutagenetix > Incidental Mutation

Incidental Mutation 'R4775:Ppp4r3a'

367868

Institutional Source

Beutler Lab

Gene Symbol

Ppp4r3a

Ensembl Gene

ENSMUSG00000041846

Gene Name

protein phosphatase 4 regulatory subunit 3A

Synonyms

1110034C04Rik, Smek1

MMRRC Submission

041991-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.387) question?

Stock #

R4775 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101039409-101083702 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101053566 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 377 (V377M)

Ref Sequence

ENSEMBL: ENSMUSP00000041667 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048305] [ENSMUST00000163095] [ENSMUST00000223091]

AlphaFold

Q6P2K6

Predicted Effect

probably damaging
Transcript: ENSMUST00000048305
AA Change: V377M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000041667
Gene: ENSMUSG00000041846
AA Change: V377M

Domain	Start	End	E-Value	Type
SCOP:d1k5db_	7	96	3e-24	SMART
Pfam:SMK-1	164	357	5.8e-85	PFAM
low complexity region	407	418	N/A	INTRINSIC
low complexity region	495	503	N/A	INTRINSIC
low complexity region	705	720	N/A	INTRINSIC
low complexity region	753	770	N/A	INTRINSIC
low complexity region	795	808	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163095
AA Change: V377M

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000129654
Gene: ENSMUSG00000041846
AA Change: V377M

Domain	Start	End	E-Value	Type
SCOP:d1k5db_	7	96	4e-24	SMART
Pfam:SMK-1	166	357	2.5e-84	PFAM
low complexity region	508	516	N/A	INTRINSIC
low complexity region	718	733	N/A	INTRINSIC
low complexity region	766	783	N/A	INTRINSIC
low complexity region	808	821	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222956

Predicted Effect

probably benign
Transcript: ENSMUST00000223091

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223161

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,243,339	Y426C	probably damaging	Het
Adam7	A	G	14: 68,507,912	I621T	probably benign	Het
Adamts1	A	T	16: 85,800,390	Y260*	probably null	Het
Adgrf1	C	T	17: 43,311,163	L764F	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Atp9b	A	G	18: 80,765,769		probably null	Het
BC067074	A	T	13: 113,317,695	I92F	possibly damaging	Het
C5ar2	A	C	7: 16,237,615	L129R	probably damaging	Het
Ccdc174	G	A	6: 91,890,894		probably null	Het
Cidec	T	C	6: 113,434,734	M1V	probably null	Het
Clec16a	G	T	16: 10,638,914	R663L	probably damaging	Het
Col25a1	T	C	3: 130,182,819	C118R	possibly damaging	Het
Cox6b2	A	G	7: 4,752,075	C67R	probably damaging	Het
Cwf19l2	A	G	9: 3,430,973	Y435C	probably benign	Het
Dapk1	T	A	13: 60,749,342	S792T	probably benign	Het
Dis3l	T	A	9: 64,330,908	N101Y	probably benign	Het
Dsg4	A	G	18: 20,471,127	T884A	possibly damaging	Het
Dvl1	T	C	4: 155,858,127	W617R	probably benign	Het
Eml5	A	G	12: 98,802,307	V1503A	probably benign	Het
Engase	A	T	11: 118,482,671	D280V	probably benign	Het
F11r	T	C	1: 171,461,641	S224P	probably damaging	Het
Fanca	A	G	8: 123,296,306	V564A	probably damaging	Het
Foxj2	G	T	6: 122,833,271	Q196H	probably benign	Het
Gle1	T	C	2: 29,936,061	W51R	possibly damaging	Het
Gm94	A	G	18: 43,792,771		probably null	Het
Gm9830	A	T	9: 44,464,424		noncoding transcript	Het
Gpaa1	T	A	15: 76,334,691		probably null	Het
Grin1	C	T	2: 25,292,463	A929T	possibly damaging	Het
Grm7	T	A	6: 110,914,371	D188E	probably damaging	Het
Gtf2ird2	T	C	5: 134,214,128	F395L	probably benign	Het
Lipo1	C	A	19: 33,780,395	G225C	probably damaging	Het
Lonrf2	T	A	1: 38,818,059		probably null	Het
Marveld2	A	G	13: 100,616,795		probably benign	Het
Mpl	A	G	4: 118,448,580	L416P	probably damaging	Het
Mppe1	A	G	18: 67,226,859	L312P	possibly damaging	Het
Mpzl3	T	A	9: 45,066,432	S113T	probably damaging	Het
Mylk3	G	A	8: 85,359,060	Q149*	probably null	Het
Myt1	T	A	2: 181,822,677	I968N	probably damaging	Het
Ndc80	A	G	17: 71,514,270	Y228H	probably damaging	Het
Nelfcd	T	G	2: 174,426,576	C520G	probably damaging	Het
Nfrkb	C	A	9: 31,419,049	T1199K	possibly damaging	Het
Nipa2	A	G	7: 55,935,863	I109T	probably benign	Het
Nlrp4e	A	G	7: 23,343,100	T804A	probably benign	Het
Nsf	A	T	11: 103,872,593	I395K	possibly damaging	Het
Nt5c1b	G	A	12: 10,375,449	V331I	probably damaging	Het
Olfr389	A	G	11: 73,776,551	Y259H	probably damaging	Het
Olfr61	A	T	7: 140,637,916	I72F	probably damaging	Het
Pask	T	C	1: 93,337,524	D3G	probably damaging	Het
Pglyrp3	T	C	3: 92,025,730	V110A	possibly damaging	Het
Prr12	A	G	7: 45,051,325		probably benign	Het
Ptdss1	G	A	13: 66,987,858		probably null	Het
Qser1	A	G	2: 104,789,901	S189P	probably damaging	Het
Rph3a	T	A	5: 120,954,488	Y350F	probably benign	Het
Skint4	A	T	4: 112,136,064	H328L	probably damaging	Het
Smyd4	G	A	11: 75,391,192	C497Y	probably damaging	Het
Stk11ip	T	C	1: 75,533,853	W864R	possibly damaging	Het
Stkld1	T	A	2: 26,951,745	V543E	probably damaging	Het
Taok2	A	G	7: 126,870,768	S963P	probably damaging	Het
Tars2	A	G	3: 95,746,647	L354P	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tpcn2	A	G	7: 145,267,342	L325P	probably damaging	Het
Trappc3l	C	G	10: 34,098,811	H96Q	probably benign	Het
Trim66	A	T	7: 109,457,589	Y1120*	probably null	Het
Trio	G	A	15: 27,881,342	Q548*	probably null	Het
Wipf2	T	A	11: 98,890,732	D32E	probably benign	Het

Other mutations in Ppp4r3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Ppp4r3a	APN	12	101049794	missense	probably damaging	1.00
IGL00532:Ppp4r3a	APN	12	101044653	missense	probably damaging	1.00
IGL01359:Ppp4r3a	APN	12	101058496	missense	probably damaging	0.99
IGL01873:Ppp4r3a	APN	12	101041835	missense	possibly damaging	0.86
IGL02676:Ppp4r3a	APN	12	101042511	missense	probably benign	0.00
IGL02756:Ppp4r3a	APN	12	101058323	critical splice donor site	probably null
IGL03196:Ppp4r3a	APN	12	101049654	splice site	probably benign
IGL03206:Ppp4r3a	APN	12	101058619	missense	probably damaging	1.00
R1101:Ppp4r3a	UTSW	12	101051571	missense	probably damaging	0.98
R1434:Ppp4r3a	UTSW	12	101043524	missense	probably damaging	0.99
R1526:Ppp4r3a	UTSW	12	101040741	missense	probably damaging	0.99
R1554:Ppp4r3a	UTSW	12	101055822	missense	probably damaging	1.00
R1650:Ppp4r3a	UTSW	12	101044619	missense	probably damaging	0.99
R1766:Ppp4r3a	UTSW	12	101058482	missense	probably damaging	0.99
R2152:Ppp4r3a	UTSW	12	101042567	missense	probably damaging	0.99
R2322:Ppp4r3a	UTSW	12	101042619	missense	probably damaging	0.98
R2421:Ppp4r3a	UTSW	12	101042653	splice site	probably benign
R2422:Ppp4r3a	UTSW	12	101042653	splice site	probably benign
R2859:Ppp4r3a	UTSW	12	101042647	critical splice acceptor site	probably null
R2884:Ppp4r3a	UTSW	12	101068677	missense	probably damaging	0.99
R4157:Ppp4r3a	UTSW	12	101055619	missense	probably damaging	0.97
R4651:Ppp4r3a	UTSW	12	101082911	utr 5 prime	probably benign
R4652:Ppp4r3a	UTSW	12	101082911	utr 5 prime	probably benign
R4706:Ppp4r3a	UTSW	12	101041916	missense	probably damaging	1.00
R4773:Ppp4r3a	UTSW	12	101082767	missense	possibly damaging	0.93
R5467:Ppp4r3a	UTSW	12	101043470	missense	probably damaging	0.99
R5634:Ppp4r3a	UTSW	12	101043521	missense	probably damaging	1.00
R5704:Ppp4r3a	UTSW	12	101083360	utr 5 prime	probably benign
R5707:Ppp4r3a	UTSW	12	101058511	missense	probably damaging	1.00
R5935:Ppp4r3a	UTSW	12	101051613	missense	probably damaging	1.00
R5969:Ppp4r3a	UTSW	12	101043579	missense	probably benign
R6030:Ppp4r3a	UTSW	12	101058400	missense	probably damaging	0.97
R6030:Ppp4r3a	UTSW	12	101058400	missense	probably damaging	0.97
R6630:Ppp4r3a	UTSW	12	101049776	missense	probably damaging	1.00
R7265:Ppp4r3a	UTSW	12	101053511	missense	possibly damaging	0.77
R7352:Ppp4r3a	UTSW	12	101041832	missense	probably damaging	1.00
R7402:Ppp4r3a	UTSW	12	101058794	missense	possibly damaging	0.94
R7761:Ppp4r3a	UTSW	12	101055821	missense	probably damaging	0.98
R7808:Ppp4r3a	UTSW	12	101053496	missense	possibly damaging	0.94
R7811:Ppp4r3a	UTSW	12	101053562	missense	probably damaging	0.98
R8062:Ppp4r3a	UTSW	12	101041971	missense	probably damaging	0.98
R8409:Ppp4r3a	UTSW	12	101042493	missense	probably benign	0.02
R8435:Ppp4r3a	UTSW	12	101082789	missense	probably benign	0.19
R8471:Ppp4r3a	UTSW	12	101055642	missense	probably benign	0.01
R9010:Ppp4r3a	UTSW	12	101058332	missense	possibly damaging	0.58
R9137:Ppp4r3a	UTSW	12	101055535	missense	possibly damaging	0.95
R9335:Ppp4r3a	UTSW	12	101040754	missense	probably damaging	1.00
R9336:Ppp4r3a	UTSW	12	101049660	missense	probably benign
R9666:Ppp4r3a	UTSW	12	101082870	start codon destroyed	probably null	0.39
R9752:Ppp4r3a	UTSW	12	101042504	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGACTACCTGTTCCCCAAAAG -3'
(R):5'- TGCTGGAACATCAAGCAGC -3'

Sequencing Primer
(F):5'- CCTGTTCCCCAAAAGTAGTTTAG -3'
(R):5'- TGCTGGAACATCAAGCAGCTTAAC -3'

Posted On

2015-12-29