Incidental Mutation 'R4775:Ppp4r3a'
List |< first << previous [record 50 of 66] next >> last >|
ID367868
Institutional Source Beutler Lab
Gene Symbol Ppp4r3a
Ensembl Gene ENSMUSG00000041846
Gene Nameprotein phosphatase 4 regulatory subunit 3A
Synonyms1110034C04Rik, Smek1
MMRRC Submission 041991-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R4775 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101039409-101083702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101053566 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 377 (V377M)
Ref Sequence ENSEMBL: ENSMUSP00000041667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048305] [ENSMUST00000163095] [ENSMUST00000223091]
Predicted Effect probably damaging
Transcript: ENSMUST00000048305
AA Change: V377M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041667
Gene: ENSMUSG00000041846
AA Change: V377M

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 3e-24 SMART
Pfam:SMK-1 164 357 5.8e-85 PFAM
low complexity region 407 418 N/A INTRINSIC
low complexity region 495 503 N/A INTRINSIC
low complexity region 705 720 N/A INTRINSIC
low complexity region 753 770 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163095
AA Change: V377M

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129654
Gene: ENSMUSG00000041846
AA Change: V377M

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 4e-24 SMART
Pfam:SMK-1 166 357 2.5e-84 PFAM
low complexity region 508 516 N/A INTRINSIC
low complexity region 718 733 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
low complexity region 808 821 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222956
Predicted Effect probably benign
Transcript: ENSMUST00000223091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223161
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,243,339 Y426C probably damaging Het
Adam7 A G 14: 68,507,912 I621T probably benign Het
Adamts1 A T 16: 85,800,390 Y260* probably null Het
Adgrf1 C T 17: 43,311,163 L764F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Atp9b A G 18: 80,765,769 probably null Het
BC067074 A T 13: 113,317,695 I92F possibly damaging Het
C5ar2 A C 7: 16,237,615 L129R probably damaging Het
Ccdc174 G A 6: 91,890,894 probably null Het
Cidec T C 6: 113,434,734 M1V probably null Het
Clec16a G T 16: 10,638,914 R663L probably damaging Het
Col25a1 T C 3: 130,182,819 C118R possibly damaging Het
Cox6b2 A G 7: 4,752,075 C67R probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
Dapk1 T A 13: 60,749,342 S792T probably benign Het
Dis3l T A 9: 64,330,908 N101Y probably benign Het
Dsg4 A G 18: 20,471,127 T884A possibly damaging Het
Dvl1 T C 4: 155,858,127 W617R probably benign Het
Eml5 A G 12: 98,802,307 V1503A probably benign Het
Engase A T 11: 118,482,671 D280V probably benign Het
F11r T C 1: 171,461,641 S224P probably damaging Het
Fanca A G 8: 123,296,306 V564A probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gle1 T C 2: 29,936,061 W51R possibly damaging Het
Gm94 A G 18: 43,792,771 probably null Het
Gm9830 A T 9: 44,464,424 noncoding transcript Het
Gpaa1 T A 15: 76,334,691 probably null Het
Grin1 C T 2: 25,292,463 A929T possibly damaging Het
Grm7 T A 6: 110,914,371 D188E probably damaging Het
Gtf2ird2 T C 5: 134,214,128 F395L probably benign Het
Lipo1 C A 19: 33,780,395 G225C probably damaging Het
Lonrf2 T A 1: 38,818,059 probably null Het
Marveld2 A G 13: 100,616,795 probably benign Het
Mpl A G 4: 118,448,580 L416P probably damaging Het
Mppe1 A G 18: 67,226,859 L312P possibly damaging Het
Mpzl3 T A 9: 45,066,432 S113T probably damaging Het
Mylk3 G A 8: 85,359,060 Q149* probably null Het
Myt1 T A 2: 181,822,677 I968N probably damaging Het
Ndc80 A G 17: 71,514,270 Y228H probably damaging Het
Nelfcd T G 2: 174,426,576 C520G probably damaging Het
Nfrkb C A 9: 31,419,049 T1199K possibly damaging Het
Nipa2 A G 7: 55,935,863 I109T probably benign Het
Nlrp4e A G 7: 23,343,100 T804A probably benign Het
Nsf A T 11: 103,872,593 I395K possibly damaging Het
Nt5c1b G A 12: 10,375,449 V331I probably damaging Het
Olfr389 A G 11: 73,776,551 Y259H probably damaging Het
Olfr61 A T 7: 140,637,916 I72F probably damaging Het
Pask T C 1: 93,337,524 D3G probably damaging Het
Pglyrp3 T C 3: 92,025,730 V110A possibly damaging Het
Prr12 A G 7: 45,051,325 probably benign Het
Ptdss1 G A 13: 66,987,858 probably null Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rph3a T A 5: 120,954,488 Y350F probably benign Het
Skint4 A T 4: 112,136,064 H328L probably damaging Het
Smyd4 G A 11: 75,391,192 C497Y probably damaging Het
Stk11ip T C 1: 75,533,853 W864R possibly damaging Het
Stkld1 T A 2: 26,951,745 V543E probably damaging Het
Taok2 A G 7: 126,870,768 S963P probably damaging Het
Tars2 A G 3: 95,746,647 L354P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn2 A G 7: 145,267,342 L325P probably damaging Het
Trappc3l C G 10: 34,098,811 H96Q probably benign Het
Trim66 A T 7: 109,457,589 Y1120* probably null Het
Trio G A 15: 27,881,342 Q548* probably null Het
Wipf2 T A 11: 98,890,732 D32E probably benign Het
Other mutations in Ppp4r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ppp4r3a APN 12 101049794 missense probably damaging 1.00
IGL00532:Ppp4r3a APN 12 101044653 missense probably damaging 1.00
IGL01359:Ppp4r3a APN 12 101058496 missense probably damaging 0.99
IGL01873:Ppp4r3a APN 12 101041835 missense possibly damaging 0.86
IGL02676:Ppp4r3a APN 12 101042511 missense probably benign 0.00
IGL02756:Ppp4r3a APN 12 101058323 critical splice donor site probably null
IGL03196:Ppp4r3a APN 12 101049654 splice site probably benign
IGL03206:Ppp4r3a APN 12 101058619 missense probably damaging 1.00
R1101:Ppp4r3a UTSW 12 101051571 missense probably damaging 0.98
R1434:Ppp4r3a UTSW 12 101043524 missense probably damaging 0.99
R1526:Ppp4r3a UTSW 12 101040741 missense probably damaging 0.99
R1554:Ppp4r3a UTSW 12 101055822 missense probably damaging 1.00
R1650:Ppp4r3a UTSW 12 101044619 missense probably damaging 0.99
R1766:Ppp4r3a UTSW 12 101058482 missense probably damaging 0.99
R2152:Ppp4r3a UTSW 12 101042567 missense probably damaging 0.99
R2322:Ppp4r3a UTSW 12 101042619 missense probably damaging 0.98
R2421:Ppp4r3a UTSW 12 101042653 splice site probably benign
R2422:Ppp4r3a UTSW 12 101042653 splice site probably benign
R2859:Ppp4r3a UTSW 12 101042647 critical splice acceptor site probably null
R2884:Ppp4r3a UTSW 12 101068677 missense probably damaging 0.99
R4157:Ppp4r3a UTSW 12 101055619 missense probably damaging 0.97
R4651:Ppp4r3a UTSW 12 101082911 utr 5 prime probably benign
R4652:Ppp4r3a UTSW 12 101082911 utr 5 prime probably benign
R4706:Ppp4r3a UTSW 12 101041916 missense probably damaging 1.00
R4773:Ppp4r3a UTSW 12 101082767 missense possibly damaging 0.93
R5467:Ppp4r3a UTSW 12 101043470 missense probably damaging 0.99
R5634:Ppp4r3a UTSW 12 101043521 missense probably damaging 1.00
R5704:Ppp4r3a UTSW 12 101083360 utr 5 prime probably benign
R5707:Ppp4r3a UTSW 12 101058511 missense probably damaging 1.00
R5935:Ppp4r3a UTSW 12 101051613 missense probably damaging 1.00
R5969:Ppp4r3a UTSW 12 101043579 missense probably benign
R6030:Ppp4r3a UTSW 12 101058400 missense probably damaging 0.97
R6030:Ppp4r3a UTSW 12 101058400 missense probably damaging 0.97
R6630:Ppp4r3a UTSW 12 101049776 missense probably damaging 1.00
R7265:Ppp4r3a UTSW 12 101053511 missense possibly damaging 0.77
R7352:Ppp4r3a UTSW 12 101041832 missense probably damaging 1.00
R7402:Ppp4r3a UTSW 12 101058794 missense possibly damaging 0.94
R7761:Ppp4r3a UTSW 12 101055821 missense probably damaging 0.98
R7808:Ppp4r3a UTSW 12 101053496 missense possibly damaging 0.94
R7811:Ppp4r3a UTSW 12 101053562 missense probably damaging 0.98
R8062:Ppp4r3a UTSW 12 101041971 missense probably damaging 0.98
R8409:Ppp4r3a UTSW 12 101042493 missense probably benign 0.02
R8435:Ppp4r3a UTSW 12 101082789 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGACTACCTGTTCCCCAAAAG -3'
(R):5'- TGCTGGAACATCAAGCAGC -3'

Sequencing Primer
(F):5'- CCTGTTCCCCAAAAGTAGTTTAG -3'
(R):5'- TGCTGGAACATCAAGCAGCTTAAC -3'
Posted On2015-12-29