Mutagenetix > Incidental Mutation

Incidental Mutation 'R4776:Lct'

367889

Institutional Source

Beutler Lab

Gene Symbol

Lct

Ensembl Gene

ENSMUSG00000026354

Gene Name

lactase

Synonyms

LPH, LOC226413, Lphl

MMRRC Submission

042413-MU

Accession Numbers

Genbank: NM_001081078; MGI:104576

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4776 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128284756-128328318 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128300387 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1123 (I1123T)

Ref Sequence

ENSEMBL: ENSMUSP00000073190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073490]

AlphaFold

F8VPT3

Predicted Effect

probably damaging
Transcript: ENSMUST00000073490
AA Change: I1123T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: I1123T

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	76	226	1.6e-19	PFAM
low complexity region	322	340	N/A	INTRINSIC
Pfam:Glyco_hydro_1	380	849	4.8e-169	PFAM
low complexity region	865	875	N/A	INTRINSIC
Pfam:Glyco_hydro_1	902	1368	3.7e-181	PFAM
Pfam:Glyco_hydro_1	1377	1844	6.9e-183	PFAM
transmembrane domain	1885	1907	N/A	INTRINSIC

Meta Mutation Damage Score

0.6517

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

98% (94/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,719,535	Y683*	probably null	Het
2610028H24Rik	A	T	10: 76,457,512	M156L	probably benign	Het
4930470P17Rik	C	T	2: 170,579,724	A79T	unknown	Het
4930522L14Rik	A	G	5: 109,736,873	I373T	probably benign	Het
A830010M20Rik	C	A	5: 107,510,451	A1117E	probably damaging	Het
Amotl1	G	A	9: 14,593,373	Q217*	probably null	Het
Ankrd28	A	T	14: 31,732,054	C254S	probably damaging	Het
Ap2a1	A	G	7: 44,901,546		probably benign	Het
Arfgef3	A	T	10: 18,654,247	S245T	probably benign	Het
Arntl	A	T	7: 113,285,037	K94I	probably damaging	Het
Atp1b2	A	T	11: 69,601,561	D224E	probably damaging	Het
Boc	G	A	16: 44,487,721	R924W	probably damaging	Het
Car14	C	T	3: 95,898,873	G292D	probably benign	Het
Cenpb	T	C	2: 131,178,183		probably benign	Het
Ces1b	A	T	8: 93,063,030	D423E	possibly damaging	Het
Cfap54	T	A	10: 92,972,694	N1373I	possibly damaging	Het
Chrdl2	T	C	7: 100,006,541		probably benign	Het
Cic	T	G	7: 25,282,883	S12A	possibly damaging	Het
Csmd2	A	T	4: 128,442,892	Q1421L	probably benign	Het
D630039A03Rik	T	C	4: 57,910,452	H120R	possibly damaging	Het
Dicer1	T	A	12: 104,692,446	D1779V	probably damaging	Het
Dock9	G	T	14: 121,610,097	H1016N	possibly damaging	Het
Dxo	T	C	17: 34,838,998	L352P	probably damaging	Het
Eif2b5	T	A	16: 20,500,233	F78I	probably damaging	Het
Eri2	A	G	7: 119,784,946		probably benign	Het
Fam208b	A	G	13: 3,570,391	F2170S	probably damaging	Het
Fbxw7	T	G	3: 84,925,689	L13V	possibly damaging	Het
Fgf7	T	A	2: 126,035,783	C23*	probably null	Het
Fubp1	T	A	3: 152,222,068		probably null	Het
Gm2663	A	T	6: 40,995,953	I240N	probably damaging	Het
Gnb1l	C	T	16: 18,548,096	Q140*	probably null	Het
Gnptab	G	A	10: 88,436,528	R1010Q	probably damaging	Het
Gtf2h1	G	A	7: 46,822,878	W544*	probably null	Het
Gucy2c	C	T	6: 136,722,514	E586K	probably damaging	Het
Hc	T	A	2: 35,039,734	E232V	probably benign	Het
Ifi207	T	A	1: 173,730,056	D372V	unknown	Het
Igkv8-28	A	T	6: 70,144,118	V15E	probably benign	Het
Il1rap	A	G	16: 26,692,799	S198G	possibly damaging	Het
Lhcgr	T	C	17: 88,742,697	E467G	probably damaging	Het
Macf1	C	T	4: 123,476,015	R86K	probably benign	Het
Maml3	T	A	3: 51,856,532	Q337L	probably benign	Het
March10	T	A	11: 105,390,037	D474V	probably benign	Het
March2	G	T	17: 33,709,916	T2K	probably damaging	Het
Mast1	A	G	8: 84,937,193		probably null	Het
Med12l	T	C	3: 59,233,212	I868T	probably damaging	Het
Msrb1	T	C	17: 24,740,173	S100P	probably damaging	Het
Nlrp4c	T	C	7: 6,066,126	L342P	probably benign	Het
Nrxn3	T	A	12: 90,331,956	V417E	possibly damaging	Het
Ntng1	T	A	3: 109,934,713	D248V	probably damaging	Het
Oaz3	T	C	3: 94,434,998	Q117R	probably benign	Het
Olfr1311	A	G	2: 112,020,931	Y308H	probably benign	Het
Olfr444	A	G	6: 42,955,521	I8V	probably benign	Het
Olfr589	A	G	7: 103,155,414	L111P	probably benign	Het
Osbpl3	A	C	6: 50,300,973	S767A	probably benign	Het
Pafah1b1	A	T	11: 74,685,871		probably benign	Het
Pard6b	A	G	2: 168,098,788	T232A	probably damaging	Het
Paxip1	A	T	5: 27,765,206	C596S	probably damaging	Het
Pnpla6	T	C	8: 3,523,818	V422A	probably benign	Het
Psmd6	A	T	14: 14,120,932		probably benign	Het
Rock2	T	A	12: 16,977,740	C1353S	probably damaging	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Sel1l	T	A	12: 91,813,893	H658L	probably damaging	Het
Sh3yl1	T	A	12: 30,940,314	L105Q	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sirt1	T	C	10: 63,335,722	K227E	probably benign	Het
Slc25a34	A	T	4: 141,623,588	F37I	possibly damaging	Het
Slc39a5	T	A	10: 128,397,049	I378F	probably damaging	Het
Smarcad1	A	T	6: 65,098,824	D731V	probably null	Het
Sox6	T	G	7: 115,541,670	K483N	probably damaging	Het
Sp140	T	A	1: 85,610,828	D95E	possibly damaging	Het
Srgap1	G	T	10: 121,792,351	D882E	probably benign	Het
Syne4	T	C	7: 30,316,833		probably benign	Het
Tec	T	C	5: 72,768,776	Y289C	probably benign	Het
Tmem102	A	T	11: 69,804,802	Y115N	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trav17	T	A	14: 53,806,640	M1K	probably null	Het
Trdn	T	A	10: 33,399,082		probably null	Het
Trp53	A	T	11: 69,586,921	I8F	probably benign	Het
Ttn	T	A	2: 76,754,662	D22064V	probably damaging	Het
Ube3c	G	A	5: 29,632,838		probably null	Het
Ulk1	C	T	5: 110,788,947		probably null	Het
Upp1	T	C	11: 9,135,976	V271A	probably damaging	Het
Vmn2r4	T	C	3: 64,388,661	E901G	probably damaging	Het
Vmn2r96	G	A	17: 18,597,508	G449D	probably damaging	Het
Vps37b	T	C	5: 124,006,612	K165E	probably damaging	Het
Vwf	A	T	6: 125,566,305	I185F	possibly damaging	Het
Wasf2	A	G	4: 133,185,004	T56A	probably benign	Het
Zdhhc23	C	G	16: 43,973,589	D241H	possibly damaging	Het
Zfp276	T	C	8: 123,254,884	S57P	probably benign	Het
Zxdc	A	G	6: 90,370,518	H287R	probably damaging	Het

Other mutations in Lct

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Lct	APN	1	128287556	missense	probably benign	0.09
IGL00970:Lct	APN	1	128304068	missense	probably damaging	1.00
IGL01022:Lct	APN	1	128300859	missense	probably benign
IGL01878:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL01892:Lct	APN	1	128307605	missense	probably damaging	1.00
IGL02307:Lct	APN	1	128286590	missense	possibly damaging	0.70
IGL02434:Lct	APN	1	128303790	missense	probably damaging	0.97
IGL02559:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL02623:Lct	APN	1	128308251	missense	probably benign	0.01
IGL02818:Lct	APN	1	128300168	missense	probably damaging	1.00
IGL02949:Lct	APN	1	128313132	missense	probably benign	0.26
IGL02951:Lct	APN	1	128300211	missense	probably damaging	1.00
IGL03087:Lct	APN	1	128300375	missense	possibly damaging	0.81
IGL03227:Lct	APN	1	128327689	missense	probably benign	0.09
ANU18:Lct	UTSW	1	128308047	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0135:Lct	UTSW	1	128285123	missense	probably damaging	0.98
R0145:Lct	UTSW	1	128327895	missense	probably benign	0.00
R0179:Lct	UTSW	1	128327685	missense	probably benign
R0331:Lct	UTSW	1	128298742	splice site	probably benign
R0366:Lct	UTSW	1	128286462	missense	probably benign	0.03
R0399:Lct	UTSW	1	128300525	missense	probably damaging	1.00
R0492:Lct	UTSW	1	128300582	missense	probably damaging	1.00
R0548:Lct	UTSW	1	128285195	missense	probably damaging	1.00
R0691:Lct	UTSW	1	128308234	missense	probably benign	0.00
R0755:Lct	UTSW	1	128294135	missense	possibly damaging	0.46
R0839:Lct	UTSW	1	128286609	missense	probably benign	0.00
R1128:Lct	UTSW	1	128301309	missense	probably damaging	0.99
R1135:Lct	UTSW	1	128294124	critical splice donor site	probably null
R1321:Lct	UTSW	1	128300022	missense	probably benign
R1448:Lct	UTSW	1	128307822	missense	probably damaging	0.99
R1450:Lct	UTSW	1	128307903	missense	probably damaging	1.00
R1572:Lct	UTSW	1	128294195	missense	probably benign	0.25
R1582:Lct	UTSW	1	128300562	missense	probably damaging	1.00
R1668:Lct	UTSW	1	128287722	splice site	probably null
R1757:Lct	UTSW	1	128301257	missense	probably damaging	1.00
R1775:Lct	UTSW	1	128300301	missense	probably damaging	1.00
R1792:Lct	UTSW	1	128327942	missense	possibly damaging	0.54
R1815:Lct	UTSW	1	128300159	missense	probably damaging	1.00
R1932:Lct	UTSW	1	128294161	missense	probably damaging	1.00
R2325:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R2381:Lct	UTSW	1	128304121	nonsense	probably null
R3001:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3002:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3003:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3011:Lct	UTSW	1	128301372	missense	possibly damaging	0.74
R3082:Lct	UTSW	1	128287608	missense	probably damaging	1.00
R3683:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3684:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3726:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3886:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3887:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3888:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4019:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4027:Lct	UTSW	1	128285181	missense	probably benign	0.00
R4226:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4409:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4514:Lct	UTSW	1	128300514	missense	probably benign
R4570:Lct	UTSW	1	128299904	missense	probably benign	0.01
R5001:Lct	UTSW	1	128308241	missense	probably damaging	0.96
R5021:Lct	UTSW	1	128300565	missense	probably benign	0.38
R5318:Lct	UTSW	1	128304372	missense	probably damaging	1.00
R5330:Lct	UTSW	1	128298529	missense	probably benign	0.06
R5385:Lct	UTSW	1	128311617	missense	possibly damaging	0.63
R5499:Lct	UTSW	1	128286677	missense	probably damaging	1.00
R5508:Lct	UTSW	1	128294131	missense	probably damaging	1.00
R5642:Lct	UTSW	1	128295232	missense	probably damaging	1.00
R5724:Lct	UTSW	1	128300336	missense	probably benign
R6026:Lct	UTSW	1	128300018	missense	probably benign
R6044:Lct	UTSW	1	128307980	missense	possibly damaging	0.95
R6175:Lct	UTSW	1	128327714	missense	probably damaging	1.00
R6277:Lct	UTSW	1	128304237	missense	probably benign	0.01
R6412:Lct	UTSW	1	128327718	missense	probably benign	0.00
R6480:Lct	UTSW	1	128294320	missense	probably damaging	1.00
R6526:Lct	UTSW	1	128300478	missense	probably benign	0.05
R6620:Lct	UTSW	1	128295072	critical splice donor site	probably null
R7214:Lct	UTSW	1	128300460	missense	probably benign	0.00
R7308:Lct	UTSW	1	128319087	missense	probably benign	0.00
R7577:Lct	UTSW	1	128300732	missense	probably damaging	0.99
R7626:Lct	UTSW	1	128285195	missense	probably damaging	1.00
R7737:Lct	UTSW	1	128298693	missense	probably benign	0.12
R7901:Lct	UTSW	1	128288985	missense	probably benign	0.44
R8033:Lct	UTSW	1	128285259	missense	probably benign	0.03
R8373:Lct	UTSW	1	128303840	missense	probably damaging	1.00
R8504:Lct	UTSW	1	128287569	missense	probably damaging	1.00
R8751:Lct	UTSW	1	128293797	missense	probably benign	0.18
R8781:Lct	UTSW	1	128287524	missense	probably damaging	1.00
R8797:Lct	UTSW	1	128303947	missense	possibly damaging	0.77
R8926:Lct	UTSW	1	128300411	missense	probably damaging	1.00
R8949:Lct	UTSW	1	128294192	missense	probably damaging	1.00
R8992:Lct	UTSW	1	128300562	missense	probably damaging	1.00
R9138:Lct	UTSW	1	128300157	missense	probably benign	0.03
R9260:Lct	UTSW	1	128299967	nonsense	probably null
R9416:Lct	UTSW	1	128300592	missense	possibly damaging	0.74
R9531:Lct	UTSW	1	128307861	missense	probably benign	0.00
X0052:Lct	UTSW	1	128307630	missense	probably damaging	1.00
YA93:Lct	UTSW	1	128301320	missense	probably damaging	1.00
Z1176:Lct	UTSW	1	128287611	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCTCTTCTGTGAAGCTGGG -3'
(R):5'- GGATGACCTTTAATGAGCCTTG -3'

Sequencing Primer
(F):5'- AGGTGCTGCAGCTCACTC -3'
(R):5'- ACCTTTAATGAGCCTTGGTGTTC -3'

Posted On

2015-12-29