Incidental Mutation 'R4776:Fgf7'
ID367893
Institutional Source Beutler Lab
Gene Symbol Fgf7
Ensembl Gene ENSMUSG00000027208
Gene Namefibroblast growth factor 7
SynonymsKeratinocyte growth factor, Kgf
MMRRC Submission 042413-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4776 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location126034658-126091185 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 126035783 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 23 (C23*)
Ref Sequence ENSEMBL: ENSMUSP00000106072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064794] [ENSMUST00000110442] [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
Predicted Effect probably null
Transcript: ENSMUST00000064794
AA Change: C23*
SMART Domains Protein: ENSMUSP00000069681
Gene: ENSMUSG00000027208
AA Change: C23*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FGF 63 192 2.65e-72 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110442
AA Change: C23*
SMART Domains Protein: ENSMUSP00000106072
Gene: ENSMUSG00000027208
AA Change: C23*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FGF 63 192 2.65e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110446
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110448
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156413
Predicted Effect probably benign
Transcript: ENSMUST00000178118
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Meta Mutation Damage Score 0.9718 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is a potent epithelial cell-specific growth factor, whose mitogenic activity is predominantly exhibited in keratinocytes but not in fibroblasts and endothelial cells. Studies of mouse and rat homologs of this gene implicated roles in morphogenesis of epithelium, reepithelialization of wounds, hair development and early lung organogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal coat appearance, kidney dysplasia, spleen hypoplasia, abnormal synaptic vesicle clustering and miniature inhibitory postsynaptic currents, increased susceptibility to drug-induced seizures, and impaired thymic recovery after injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,719,535 Y683* probably null Het
2610028H24Rik A T 10: 76,457,512 M156L probably benign Het
4930470P17Rik C T 2: 170,579,724 A79T unknown Het
4930522L14Rik A G 5: 109,736,873 I373T probably benign Het
A830010M20Rik C A 5: 107,510,451 A1117E probably damaging Het
Amotl1 G A 9: 14,593,373 Q217* probably null Het
Ankrd28 A T 14: 31,732,054 C254S probably damaging Het
Ap2a1 A G 7: 44,901,546 probably benign Het
Arfgef3 A T 10: 18,654,247 S245T probably benign Het
Arntl A T 7: 113,285,037 K94I probably damaging Het
Atp1b2 A T 11: 69,601,561 D224E probably damaging Het
Boc G A 16: 44,487,721 R924W probably damaging Het
Car14 C T 3: 95,898,873 G292D probably benign Het
Cenpb T C 2: 131,178,183 probably benign Het
Ces1b A T 8: 93,063,030 D423E possibly damaging Het
Cfap54 T A 10: 92,972,694 N1373I possibly damaging Het
Chrdl2 T C 7: 100,006,541 probably benign Het
Cic T G 7: 25,282,883 S12A possibly damaging Het
Csmd2 A T 4: 128,442,892 Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 H120R possibly damaging Het
Dicer1 T A 12: 104,692,446 D1779V probably damaging Het
Dock9 G T 14: 121,610,097 H1016N possibly damaging Het
Dxo T C 17: 34,838,998 L352P probably damaging Het
Eif2b5 T A 16: 20,500,233 F78I probably damaging Het
Eri2 A G 7: 119,784,946 probably benign Het
Fam208b A G 13: 3,570,391 F2170S probably damaging Het
Fbxw7 T G 3: 84,925,689 L13V possibly damaging Het
Fubp1 T A 3: 152,222,068 probably null Het
Gm2663 A T 6: 40,995,953 I240N probably damaging Het
Gnb1l C T 16: 18,548,096 Q140* probably null Het
Gnptab G A 10: 88,436,528 R1010Q probably damaging Het
Gtf2h1 G A 7: 46,822,878 W544* probably null Het
Gucy2c C T 6: 136,722,514 E586K probably damaging Het
Hc T A 2: 35,039,734 E232V probably benign Het
Ifi207 T A 1: 173,730,056 D372V unknown Het
Igkv8-28 A T 6: 70,144,118 V15E probably benign Het
Il1rap A G 16: 26,692,799 S198G possibly damaging Het
Lct A G 1: 128,300,387 I1123T probably damaging Het
Lhcgr T C 17: 88,742,697 E467G probably damaging Het
Macf1 C T 4: 123,476,015 R86K probably benign Het
Maml3 T A 3: 51,856,532 Q337L probably benign Het
March10 T A 11: 105,390,037 D474V probably benign Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mast1 A G 8: 84,937,193 probably null Het
Med12l T C 3: 59,233,212 I868T probably damaging Het
Msrb1 T C 17: 24,740,173 S100P probably damaging Het
Nlrp4c T C 7: 6,066,126 L342P probably benign Het
Nrxn3 T A 12: 90,331,956 V417E possibly damaging Het
Ntng1 T A 3: 109,934,713 D248V probably damaging Het
Oaz3 T C 3: 94,434,998 Q117R probably benign Het
Olfr1311 A G 2: 112,020,931 Y308H probably benign Het
Olfr444 A G 6: 42,955,521 I8V probably benign Het
Olfr589 A G 7: 103,155,414 L111P probably benign Het
Osbpl3 A C 6: 50,300,973 S767A probably benign Het
Pafah1b1 A T 11: 74,685,871 probably benign Het
Pard6b A G 2: 168,098,788 T232A probably damaging Het
Paxip1 A T 5: 27,765,206 C596S probably damaging Het
Pnpla6 T C 8: 3,523,818 V422A probably benign Het
Psmd6 A T 14: 14,120,932 probably benign Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sel1l T A 12: 91,813,893 H658L probably damaging Het
Sh3yl1 T A 12: 30,940,314 L105Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sirt1 T C 10: 63,335,722 K227E probably benign Het
Slc25a34 A T 4: 141,623,588 F37I possibly damaging Het
Slc39a5 T A 10: 128,397,049 I378F probably damaging Het
Smarcad1 A T 6: 65,098,824 D731V probably null Het
Sox6 T G 7: 115,541,670 K483N probably damaging Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srgap1 G T 10: 121,792,351 D882E probably benign Het
Syne4 T C 7: 30,316,833 probably benign Het
Tec T C 5: 72,768,776 Y289C probably benign Het
Tmem102 A T 11: 69,804,802 Y115N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav17 T A 14: 53,806,640 M1K probably null Het
Trdn T A 10: 33,399,082 probably null Het
Trp53 A T 11: 69,586,921 I8F probably benign Het
Ttn T A 2: 76,754,662 D22064V probably damaging Het
Ube3c G A 5: 29,632,838 probably null Het
Ulk1 C T 5: 110,788,947 probably null Het
Upp1 T C 11: 9,135,976 V271A probably damaging Het
Vmn2r4 T C 3: 64,388,661 E901G probably damaging Het
Vmn2r96 G A 17: 18,597,508 G449D probably damaging Het
Vps37b T C 5: 124,006,612 K165E probably damaging Het
Vwf A T 6: 125,566,305 I185F possibly damaging Het
Wasf2 A G 4: 133,185,004 T56A probably benign Het
Zdhhc23 C G 16: 43,973,589 D241H possibly damaging Het
Zfp276 T C 8: 123,254,884 S57P probably benign Het
Zxdc A G 6: 90,370,518 H287R probably damaging Het
Other mutations in Fgf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Fgf7 APN 2 126089445 missense probably damaging 0.98
IGL01121:Fgf7 APN 2 126088232 intron probably benign
IGL01328:Fgf7 APN 2 126088244 missense probably damaging 1.00
IGL01403:Fgf7 APN 2 126035940 missense probably damaging 1.00
IGL01664:Fgf7 APN 2 126035987 missense probably benign 0.01
R0245:Fgf7 UTSW 2 126035955 missense probably benign 0.05
R0652:Fgf7 UTSW 2 126035955 missense probably benign 0.05
R1528:Fgf7 UTSW 2 126035818 missense probably damaging 0.98
R4105:Fgf7 UTSW 2 126035679 intron probably benign
R4974:Fgf7 UTSW 2 126088240 missense probably benign 0.00
R7293:Fgf7 UTSW 2 126035752 missense probably damaging 1.00
R8129:Fgf7 UTSW 2 126035845 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCTGTGTTCCTGAAGGAG -3'
(R):5'- AATCCTCAGGTACCACTGGG -3'

Sequencing Primer
(F):5'- GGAAAGAGCGACGACTTTTTCTCTC -3'
(R):5'- GTGCGACAGAACAGTCTTCTC -3'
Posted On2015-12-29