Incidental Mutation 'R4776:Ntng1'
ID 367904
Institutional Source Beutler Lab
Gene Symbol Ntng1
Ensembl Gene ENSMUSG00000059857
Gene Name netrin G1
Synonyms Lmnt1, A930010C08Rik
MMRRC Submission 042413-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4776 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 109687356-110051327 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 109842029 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 248 (D248V)
Ref Sequence ENSEMBL: ENSMUSP00000116579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072596] [ENSMUST00000106570] [ENSMUST00000106571] [ENSMUST00000106575] [ENSMUST00000128219] [ENSMUST00000131027] [ENSMUST00000156177] [ENSMUST00000138953] [ENSMUST00000133268] [ENSMUST00000138344]
AlphaFold Q8R4G0
Predicted Effect probably damaging
Transcript: ENSMUST00000072596
AA Change: D248V

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072397
Gene: ENSMUSG00000059857
AA Change: D248V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF_Lam 420 462 5.74e-6 SMART
EGF 466 498 5.12e-3 SMART
low complexity region 522 537 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106570
AA Change: D248V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102180
Gene: ENSMUSG00000059857
AA Change: D248V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 355 1.28e-3 SMART
EGF 388 420 5.12e-3 SMART
low complexity region 444 459 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106571
AA Change: D248V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102181
Gene: ENSMUSG00000059857
AA Change: D248V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 408 440 5.12e-3 SMART
low complexity region 464 479 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106575
AA Change: D248V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102185
Gene: ENSMUSG00000059857
AA Change: D248V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 355 3.33e-2 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF_Lam 420 462 5.74e-6 SMART
EGF 466 498 5.12e-3 SMART
low complexity region 522 537 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128219
AA Change: D248V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116579
Gene: ENSMUSG00000059857
AA Change: D248V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LamNT 59 295 1.5e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131027
AA Change: D248V

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118800
Gene: ENSMUSG00000059857
AA Change: D248V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF 421 453 5.12e-3 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189335
Predicted Effect probably damaging
Transcript: ENSMUST00000156177
AA Change: D248V

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119534
Gene: ENSMUSG00000059857
AA Change: D248V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 387 419 5.12e-3 SMART
low complexity region 443 458 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138953
AA Change: D248V

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116213
Gene: ENSMUSG00000059857
AA Change: D248V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 407 439 5.12e-3 SMART
low complexity region 463 478 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133268
AA Change: D248V

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117371
Gene: ENSMUSG00000059857
AA Change: D248V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 365 397 5.12e-3 SMART
low complexity region 421 436 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138344
AA Change: D248V

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120688
Gene: ENSMUSG00000059857
AA Change: D248V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 406 5.74e-6 SMART
EGF 410 442 5.12e-3 SMART
low complexity region 466 481 N/A INTRINSIC
Meta Mutation Damage Score 0.7956 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is processed into a secreted protein containing eukaroytic growth factor (EGF)-like domains. This protein acts to guide axon growth during neuronal development. Polymorphisms in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele survive into adulthood with no major alterations in gross brain cytoarchitecture or axonal projection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,293,346 (GRCm39) M156L probably benign Het
4930470P17Rik C T 2: 170,421,644 (GRCm39) A79T unknown Het
4930522L14Rik A G 5: 109,884,739 (GRCm39) I373T probably benign Het
Amotl1 G A 9: 14,504,669 (GRCm39) Q217* probably null Het
Ankrd28 A T 14: 31,454,011 (GRCm39) C254S probably damaging Het
Ap2a1 A G 7: 44,550,970 (GRCm39) probably benign Het
Arfgef3 A T 10: 18,529,995 (GRCm39) S245T probably benign Het
Atp1b2 A T 11: 69,492,387 (GRCm39) D224E probably damaging Het
Bmal1 A T 7: 112,884,244 (GRCm39) K94I probably damaging Het
Boc G A 16: 44,308,084 (GRCm39) R924W probably damaging Het
Btbd8 C A 5: 107,658,317 (GRCm39) A1117E probably damaging Het
Car14 C T 3: 95,806,185 (GRCm39) G292D probably benign Het
Cenpb T C 2: 131,020,103 (GRCm39) probably benign Het
Ces1b A T 8: 93,789,658 (GRCm39) D423E possibly damaging Het
Cfap54 T A 10: 92,808,556 (GRCm39) N1373I possibly damaging Het
Chrdl2 T C 7: 99,655,748 (GRCm39) probably benign Het
Cic T G 7: 24,982,308 (GRCm39) S12A possibly damaging Het
Csmd2 A T 4: 128,336,685 (GRCm39) Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 (GRCm39) H120R possibly damaging Het
Dicer1 T A 12: 104,658,705 (GRCm39) D1779V probably damaging Het
Dock9 G T 14: 121,847,509 (GRCm39) H1016N possibly damaging Het
Dxo T C 17: 35,057,974 (GRCm39) L352P probably damaging Het
Eif2b5 T A 16: 20,318,983 (GRCm39) F78I probably damaging Het
Eri2 A G 7: 119,384,169 (GRCm39) probably benign Het
Fbxw7 T G 3: 84,832,996 (GRCm39) L13V possibly damaging Het
Fgf7 T A 2: 125,877,703 (GRCm39) C23* probably null Het
Fubp1 T A 3: 151,927,705 (GRCm39) probably null Het
Gm2663 A T 6: 40,972,887 (GRCm39) I240N probably damaging Het
Gnb1l C T 16: 18,366,846 (GRCm39) Q140* probably null Het
Gnptab G A 10: 88,272,390 (GRCm39) R1010Q probably damaging Het
Gtf2h1 G A 7: 46,472,302 (GRCm39) W544* probably null Het
Gucy2c C T 6: 136,699,512 (GRCm39) E586K probably damaging Het
Hc T A 2: 34,929,746 (GRCm39) E232V probably benign Het
Ifi207 T A 1: 173,557,622 (GRCm39) D372V unknown Het
Igkv8-28 A T 6: 70,121,102 (GRCm39) V15E probably benign Het
Il1rap A G 16: 26,511,549 (GRCm39) S198G possibly damaging Het
Lct A G 1: 128,228,124 (GRCm39) I1123T probably damaging Het
Lhcgr T C 17: 89,050,125 (GRCm39) E467G probably damaging Het
Macf1 C T 4: 123,369,808 (GRCm39) R86K probably benign Het
Maml3 T A 3: 51,763,953 (GRCm39) Q337L probably benign Het
Marchf10 T A 11: 105,280,863 (GRCm39) D474V probably benign Het
Marchf2 G T 17: 33,928,890 (GRCm39) T2K probably damaging Het
Mast1 A G 8: 85,663,822 (GRCm39) probably null Het
Med12l T C 3: 59,140,633 (GRCm39) I868T probably damaging Het
Msrb1 T C 17: 24,959,147 (GRCm39) S100P probably damaging Het
Nlrp4c T C 7: 6,069,125 (GRCm39) L342P probably benign Het
Nrxn3 T A 12: 90,298,730 (GRCm39) V417E possibly damaging Het
Oaz3 T C 3: 94,342,305 (GRCm39) Q117R probably benign Het
Or2a56 A G 6: 42,932,455 (GRCm39) I8V probably benign Het
Or4f58 A G 2: 111,851,276 (GRCm39) Y308H probably benign Het
Or52e2 A G 7: 102,804,621 (GRCm39) L111P probably benign Het
Osbpl3 A C 6: 50,277,953 (GRCm39) S767A probably benign Het
Pafah1b1 A T 11: 74,576,697 (GRCm39) probably benign Het
Pard6b A G 2: 167,940,708 (GRCm39) T232A probably damaging Het
Paxip1 A T 5: 27,970,204 (GRCm39) C596S probably damaging Het
Pnpla6 T C 8: 3,573,818 (GRCm39) V422A probably benign Het
Psmd6 A T 14: 14,120,932 (GRCm38) probably benign Het
Relch T A 1: 105,647,260 (GRCm39) Y683* probably null Het
Rock2 T A 12: 17,027,741 (GRCm39) C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Sel1l T A 12: 91,780,667 (GRCm39) H658L probably damaging Het
Sh3yl1 T A 12: 30,990,313 (GRCm39) L105Q probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sirt1 T C 10: 63,171,501 (GRCm39) K227E probably benign Het
Slc25a34 A T 4: 141,350,899 (GRCm39) F37I possibly damaging Het
Slc39a5 T A 10: 128,232,918 (GRCm39) I378F probably damaging Het
Smarcad1 A T 6: 65,075,808 (GRCm39) D731V probably null Het
Sox6 T G 7: 115,140,905 (GRCm39) K483N probably damaging Het
Sp140 T A 1: 85,538,549 (GRCm39) D95E possibly damaging Het
Srgap1 G T 10: 121,628,256 (GRCm39) D882E probably benign Het
Syne4 T C 7: 30,016,258 (GRCm39) probably benign Het
Tasor2 A G 13: 3,620,391 (GRCm39) F2170S probably damaging Het
Tec T C 5: 72,926,119 (GRCm39) Y289C probably benign Het
Tmem102 A T 11: 69,695,628 (GRCm39) Y115N probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trav17 T A 14: 54,044,097 (GRCm39) M1K probably null Het
Trdn T A 10: 33,275,078 (GRCm39) probably null Het
Trp53 A T 11: 69,477,747 (GRCm39) I8F probably benign Het
Ttn T A 2: 76,585,006 (GRCm39) D22064V probably damaging Het
Ube3c G A 5: 29,837,836 (GRCm39) probably null Het
Ulk1 C T 5: 110,936,813 (GRCm39) probably null Het
Upp1 T C 11: 9,085,976 (GRCm39) V271A probably damaging Het
Vmn2r4 T C 3: 64,296,082 (GRCm39) E901G probably damaging Het
Vmn2r96 G A 17: 18,817,770 (GRCm39) G449D probably damaging Het
Vps37b T C 5: 124,144,675 (GRCm39) K165E probably damaging Het
Vwf A T 6: 125,543,268 (GRCm39) I185F possibly damaging Het
Wasf2 A G 4: 132,912,315 (GRCm39) T56A probably benign Het
Zdhhc23 C G 16: 43,793,952 (GRCm39) D241H possibly damaging Het
Zfp276 T C 8: 123,981,623 (GRCm39) S57P probably benign Het
Zxdc A G 6: 90,347,500 (GRCm39) H287R probably damaging Het
Other mutations in Ntng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Ntng1 APN 3 109,842,311 (GRCm39) nonsense probably null
IGL02367:Ntng1 APN 3 110,042,829 (GRCm39) splice site probably null
IGL02448:Ntng1 APN 3 109,841,875 (GRCm39) splice site probably benign
IGL02487:Ntng1 APN 3 109,842,363 (GRCm39) missense probably damaging 0.98
IGL02500:Ntng1 APN 3 110,042,646 (GRCm39) missense probably damaging 1.00
IGL02578:Ntng1 APN 3 110,042,710 (GRCm39) missense probably benign 0.01
IGL03009:Ntng1 APN 3 109,842,018 (GRCm39) missense possibly damaging 0.89
IGL03096:Ntng1 APN 3 110,042,665 (GRCm39) missense probably benign 0.19
R0108:Ntng1 UTSW 3 109,759,071 (GRCm39) splice site probably benign
R0326:Ntng1 UTSW 3 110,042,819 (GRCm39) nonsense probably null
R0403:Ntng1 UTSW 3 109,841,927 (GRCm39) missense probably damaging 0.97
R0699:Ntng1 UTSW 3 109,779,611 (GRCm39) missense probably damaging 1.00
R0702:Ntng1 UTSW 3 109,779,570 (GRCm39) missense probably damaging 1.00
R1981:Ntng1 UTSW 3 109,842,326 (GRCm39) missense possibly damaging 0.61
R2096:Ntng1 UTSW 3 109,739,871 (GRCm39) missense probably damaging 0.99
R3739:Ntng1 UTSW 3 109,842,007 (GRCm39) missense probably damaging 1.00
R3963:Ntng1 UTSW 3 109,842,184 (GRCm39) missense probably damaging 1.00
R4484:Ntng1 UTSW 3 110,051,124 (GRCm39) unclassified probably benign
R4516:Ntng1 UTSW 3 109,842,329 (GRCm39) missense probably damaging 1.00
R4518:Ntng1 UTSW 3 109,842,329 (GRCm39) missense probably damaging 1.00
R4520:Ntng1 UTSW 3 109,842,312 (GRCm39) missense probably damaging 1.00
R4523:Ntng1 UTSW 3 109,842,312 (GRCm39) missense probably damaging 1.00
R4524:Ntng1 UTSW 3 109,842,312 (GRCm39) missense probably damaging 1.00
R4817:Ntng1 UTSW 3 109,842,184 (GRCm39) missense probably damaging 1.00
R4827:Ntng1 UTSW 3 110,042,727 (GRCm39) missense probably damaging 1.00
R4990:Ntng1 UTSW 3 110,042,577 (GRCm39) critical splice donor site probably null
R5067:Ntng1 UTSW 3 110,042,661 (GRCm39) missense possibly damaging 0.95
R5087:Ntng1 UTSW 3 110,042,645 (GRCm39) nonsense probably null
R5196:Ntng1 UTSW 3 109,842,299 (GRCm39) missense probably damaging 1.00
R5263:Ntng1 UTSW 3 109,842,188 (GRCm39) missense probably damaging 0.99
R5743:Ntng1 UTSW 3 110,042,736 (GRCm39) missense probably damaging 1.00
R6268:Ntng1 UTSW 3 109,842,351 (GRCm39) missense probably damaging 1.00
R6292:Ntng1 UTSW 3 110,051,202 (GRCm39) unclassified probably benign
R6419:Ntng1 UTSW 3 109,690,169 (GRCm39) missense possibly damaging 0.95
R6898:Ntng1 UTSW 3 109,779,534 (GRCm39) missense probably damaging 0.98
R7081:Ntng1 UTSW 3 109,759,105 (GRCm39) missense probably benign 0.00
R7090:Ntng1 UTSW 3 109,842,496 (GRCm39) nonsense probably null
R7134:Ntng1 UTSW 3 109,842,445 (GRCm39) missense probably benign
R7302:Ntng1 UTSW 3 109,739,933 (GRCm39) missense possibly damaging 0.94
R7353:Ntng1 UTSW 3 110,042,763 (GRCm39) missense probably damaging 1.00
R7408:Ntng1 UTSW 3 109,760,398 (GRCm39) missense probably benign 0.00
R7610:Ntng1 UTSW 3 109,842,141 (GRCm39) missense probably damaging 1.00
R7686:Ntng1 UTSW 3 109,842,330 (GRCm39) missense possibly damaging 0.80
R7972:Ntng1 UTSW 3 110,042,802 (GRCm39) missense probably benign 0.02
R9210:Ntng1 UTSW 3 109,779,633 (GRCm39) missense probably damaging 1.00
R9214:Ntng1 UTSW 3 109,841,921 (GRCm39) missense probably damaging 1.00
R9266:Ntng1 UTSW 3 110,051,162 (GRCm39) missense unknown
R9266:Ntng1 UTSW 3 110,050,923 (GRCm39) unclassified probably benign
R9364:Ntng1 UTSW 3 110,042,680 (GRCm39) missense probably damaging 0.97
R9593:Ntng1 UTSW 3 109,842,224 (GRCm39) missense probably damaging 1.00
R9596:Ntng1 UTSW 3 110,042,956 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCAAGATGGGCATGTGTTCTC -3'
(R):5'- GAACATGGCAGCCCTATCAG -3'

Sequencing Primer
(F):5'- CAAGATGGGCATGTGTTCTCTTACC -3'
(R):5'- ACATGGCAGCCCTATCAGTATTATGC -3'
Posted On 2015-12-29