Mutagenetix > Incidental Mutation

Incidental Mutation 'R4776:Shroom3'

367915

Institutional Source

Beutler Lab

Gene Symbol

Shroom3

Ensembl Gene

ENSMUSG00000029381

Gene Name

shroom family member 3

Synonyms

D5Ertd287e, Shrm3, Shrm

MMRRC Submission

042413-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4776 (G1)

Quality Score

149

Status

Validated

Chromosome

Chromosomal Location

92683435-92965318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 92943086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 1151 (V1151F)

Ref Sequence

ENSEMBL: ENSMUSP00000153516 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
Pfam:ASD1	882	1060	1e-57	PFAM
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1307	1318	N/A	INTRINSIC
low complexity region	1347	1359	N/A	INTRINSIC
low complexity region	1449	1463	N/A	INTRINSIC
low complexity region	1508	1520	N/A	INTRINSIC
Pfam:ASD2	1654	1940	9.9e-112	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000168878
AA Change: V1101F

SMART Domains

Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
low complexity region	1176	1187	N/A	INTRINSIC
low complexity region	1216	1228	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1377	1389	N/A	INTRINSIC
Pfam:ASD2	1522	1809	8.9e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172706

SMART Domains

Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200869

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201800

Predicted Effect

probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

98% (94/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,719,535	Y683*	probably null	Het
2610028H24Rik	A	T	10: 76,457,512	M156L	probably benign	Het
4930470P17Rik	C	T	2: 170,579,724	A79T	unknown	Het
4930522L14Rik	A	G	5: 109,736,873	I373T	probably benign	Het
A830010M20Rik	C	A	5: 107,510,451	A1117E	probably damaging	Het
Amotl1	G	A	9: 14,593,373	Q217*	probably null	Het
Ankrd28	A	T	14: 31,732,054	C254S	probably damaging	Het
Ap2a1	A	G	7: 44,901,546		probably benign	Het
Arfgef3	A	T	10: 18,654,247	S245T	probably benign	Het
Arntl	A	T	7: 113,285,037	K94I	probably damaging	Het
Atp1b2	A	T	11: 69,601,561	D224E	probably damaging	Het
Boc	G	A	16: 44,487,721	R924W	probably damaging	Het
Car14	C	T	3: 95,898,873	G292D	probably benign	Het
Cenpb	T	C	2: 131,178,183		probably benign	Het
Ces1b	A	T	8: 93,063,030	D423E	possibly damaging	Het
Cfap54	T	A	10: 92,972,694	N1373I	possibly damaging	Het
Chrdl2	T	C	7: 100,006,541		probably benign	Het
Cic	T	G	7: 25,282,883	S12A	possibly damaging	Het
Csmd2	A	T	4: 128,442,892	Q1421L	probably benign	Het
D630039A03Rik	T	C	4: 57,910,452	H120R	possibly damaging	Het
Dicer1	T	A	12: 104,692,446	D1779V	probably damaging	Het
Dock9	G	T	14: 121,610,097	H1016N	possibly damaging	Het
Dxo	T	C	17: 34,838,998	L352P	probably damaging	Het
Eif2b5	T	A	16: 20,500,233	F78I	probably damaging	Het
Eri2	A	G	7: 119,784,946		probably benign	Het
Fam208b	A	G	13: 3,570,391	F2170S	probably damaging	Het
Fbxw7	T	G	3: 84,925,689	L13V	possibly damaging	Het
Fgf7	T	A	2: 126,035,783	C23*	probably null	Het
Fubp1	T	A	3: 152,222,068		probably null	Het
Gm2663	A	T	6: 40,995,953	I240N	probably damaging	Het
Gnb1l	C	T	16: 18,548,096	Q140*	probably null	Het
Gnptab	G	A	10: 88,436,528	R1010Q	probably damaging	Het
Gtf2h1	G	A	7: 46,822,878	W544*	probably null	Het
Gucy2c	C	T	6: 136,722,514	E586K	probably damaging	Het
Hc	T	A	2: 35,039,734	E232V	probably benign	Het
Ifi207	T	A	1: 173,730,056	D372V	unknown	Het
Igkv8-28	A	T	6: 70,144,118	V15E	probably benign	Het
Il1rap	A	G	16: 26,692,799	S198G	possibly damaging	Het
Lct	A	G	1: 128,300,387	I1123T	probably damaging	Het
Lhcgr	T	C	17: 88,742,697	E467G	probably damaging	Het
Macf1	C	T	4: 123,476,015	R86K	probably benign	Het
Maml3	T	A	3: 51,856,532	Q337L	probably benign	Het
March10	T	A	11: 105,390,037	D474V	probably benign	Het
March2	G	T	17: 33,709,916	T2K	probably damaging	Het
Mast1	A	G	8: 84,937,193		probably null	Het
Med12l	T	C	3: 59,233,212	I868T	probably damaging	Het
Msrb1	T	C	17: 24,740,173	S100P	probably damaging	Het
Nlrp4c	T	C	7: 6,066,126	L342P	probably benign	Het
Nrxn3	T	A	12: 90,331,956	V417E	possibly damaging	Het
Ntng1	T	A	3: 109,934,713	D248V	probably damaging	Het
Oaz3	T	C	3: 94,434,998	Q117R	probably benign	Het
Olfr1311	A	G	2: 112,020,931	Y308H	probably benign	Het
Olfr444	A	G	6: 42,955,521	I8V	probably benign	Het
Olfr589	A	G	7: 103,155,414	L111P	probably benign	Het
Osbpl3	A	C	6: 50,300,973	S767A	probably benign	Het
Pafah1b1	A	T	11: 74,685,871		probably benign	Het
Pard6b	A	G	2: 168,098,788	T232A	probably damaging	Het
Paxip1	A	T	5: 27,765,206	C596S	probably damaging	Het
Pnpla6	T	C	8: 3,523,818	V422A	probably benign	Het
Psmd6	A	T	14: 14,120,932		probably benign	Het
Rock2	T	A	12: 16,977,740	C1353S	probably damaging	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Sel1l	T	A	12: 91,813,893	H658L	probably damaging	Het
Sh3yl1	T	A	12: 30,940,314	L105Q	probably damaging	Het
Sirt1	T	C	10: 63,335,722	K227E	probably benign	Het
Slc25a34	A	T	4: 141,623,588	F37I	possibly damaging	Het
Slc39a5	T	A	10: 128,397,049	I378F	probably damaging	Het
Smarcad1	A	T	6: 65,098,824	D731V	probably null	Het
Sox6	T	G	7: 115,541,670	K483N	probably damaging	Het
Sp140	T	A	1: 85,610,828	D95E	possibly damaging	Het
Srgap1	G	T	10: 121,792,351	D882E	probably benign	Het
Syne4	T	C	7: 30,316,833		probably benign	Het
Tec	T	C	5: 72,768,776	Y289C	probably benign	Het
Tmem102	A	T	11: 69,804,802	Y115N	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trav17	T	A	14: 53,806,640	M1K	probably null	Het
Trdn	T	A	10: 33,399,082		probably null	Het
Trp53	A	T	11: 69,586,921	I8F	probably benign	Het
Ttn	T	A	2: 76,754,662	D22064V	probably damaging	Het
Ube3c	G	A	5: 29,632,838		probably null	Het
Ulk1	C	T	5: 110,788,947		probably null	Het
Upp1	T	C	11: 9,135,976	V271A	probably damaging	Het
Vmn2r4	T	C	3: 64,388,661	E901G	probably damaging	Het
Vmn2r96	G	A	17: 18,597,508	G449D	probably damaging	Het
Vps37b	T	C	5: 124,006,612	K165E	probably damaging	Het
Vwf	A	T	6: 125,566,305	I185F	possibly damaging	Het
Wasf2	A	G	4: 133,185,004	T56A	probably benign	Het
Zdhhc23	C	G	16: 43,973,589	D241H	possibly damaging	Het
Zfp276	T	C	8: 123,254,884	S57P	probably benign	Het
Zxdc	A	G	6: 90,370,518	H287R	probably damaging	Het

Other mutations in Shroom3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Shroom3	APN	5	92951065	missense	probably damaging	1.00
IGL01086:Shroom3	APN	5	92948452	missense	probably benign	0.01
IGL01363:Shroom3	APN	5	92940993	missense	probably benign	0.01
IGL01468:Shroom3	APN	5	92940342	missense	probably damaging	1.00
IGL01675:Shroom3	APN	5	92941680	missense	probably damaging	0.99
IGL01862:Shroom3	APN	5	92962289	missense	probably damaging	1.00
IGL01987:Shroom3	APN	5	92942189	missense	probably damaging	0.99
IGL02104:Shroom3	APN	5	92940389	missense	probably benign	0.32
IGL03248:Shroom3	APN	5	92952540	missense	probably benign	0.00
IGL03386:Shroom3	APN	5	92948483	splice site	probably benign
R0167:Shroom3	UTSW	5	92948395	splice site	probably benign
R0388:Shroom3	UTSW	5	92951293	missense	probably benign	0.39
R0395:Shroom3	UTSW	5	92780903	missense	probably damaging	1.00
R0567:Shroom3	UTSW	5	92964453	missense	possibly damaging	0.53
R1496:Shroom3	UTSW	5	92942834	missense	possibly damaging	0.69
R1772:Shroom3	UTSW	5	92940656	missense	probably damaging	0.97
R1845:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R1921:Shroom3	UTSW	5	92962365	critical splice donor site	probably null
R2059:Shroom3	UTSW	5	92683784	missense	probably damaging	1.00
R2203:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2301:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2344:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2345:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2346:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2348:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2371:Shroom3	UTSW	5	92780870	missense	probably damaging	1.00
R2435:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2829:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2830:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2831:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2897:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2898:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3080:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3433:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3729:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3730:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3735:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3736:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3851:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3852:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3943:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3969:Shroom3	UTSW	5	92940879	missense	probably benign	0.05
R4008:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4009:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4012:Shroom3	UTSW	5	92948483	splice site	probably benign
R4154:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4157:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4172:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4173:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4201:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4202:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4206:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4284:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4285:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4364:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4384:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4456:Shroom3	UTSW	5	92940999	missense	probably benign	0.14
R4707:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4712:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4751:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4755:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4760:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4773:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4774:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4801:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4802:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4856:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4857:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4882:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4883:Shroom3	UTSW	5	92951134	missense	probably benign	0.14
R4886:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R5262:Shroom3	UTSW	5	92964573	missense	probably damaging	1.00
R5271:Shroom3	UTSW	5	92962248	missense	probably damaging	1.00
R5719:Shroom3	UTSW	5	92943018	missense	probably benign	0.04
R5726:Shroom3	UTSW	5	92943005	missense	probably benign	0.00
R5993:Shroom3	UTSW	5	92940188	missense	probably damaging	1.00
R6078:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6138:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6153:Shroom3	UTSW	5	92964408	missense	probably damaging	0.99
R6493:Shroom3	UTSW	5	92941561	missense	probably benign	0.03
R6495:Shroom3	UTSW	5	92942069	missense	possibly damaging	0.66
R6693:Shroom3	UTSW	5	92940758	missense	possibly damaging	0.61
R6801:Shroom3	UTSW	5	92940936	missense	probably damaging	1.00
R6893:Shroom3	UTSW	5	92942204	missense	probably damaging	0.97
R6912:Shroom3	UTSW	5	92943017	missense	probably benign	0.02
R6924:Shroom3	UTSW	5	92964403	missense	probably damaging	1.00
R7083:Shroom3	UTSW	5	92964525	missense	probably damaging	1.00
R7197:Shroom3	UTSW	5	92942604	missense	probably damaging	1.00
R7366:Shroom3	UTSW	5	92964606	nonsense	probably null
R7712:Shroom3	UTSW	5	92950947	missense	probably benign	0.01
R7725:Shroom3	UTSW	5	92941653	missense	probably benign	0.19
R7728:Shroom3	UTSW	5	92683707	missense	possibly damaging	0.73
R7774:Shroom3	UTSW	5	92950489	missense	probably damaging	0.98
R7795:Shroom3	UTSW	5	92919649	missense	probably damaging	0.99
R7821:Shroom3	UTSW	5	92940846	missense	probably damaging	0.98
R7971:Shroom3	UTSW	5	92951074	missense	probably damaging	1.00
R8276:Shroom3	UTSW	5	92940480	missense	probably damaging	0.99
R8934:Shroom3	UTSW	5	92941725	missense	probably damaging	1.00
R8938:Shroom3	UTSW	5	92943071	missense	probably damaging	1.00
R9083:Shroom3	UTSW	5	92950674	missense	probably damaging	0.97
R9108:Shroom3	UTSW	5	92940116	missense	probably damaging	1.00
R9124:Shroom3	UTSW	5	92964542	missense	probably benign	0.19
R9295:Shroom3	UTSW	5	92950619	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAGGAGCACACTCATCCGTC -3'
(R):5'- TTAACTGTCAGAACGGTAACCAAC -3'

Sequencing Primer
(F):5'- GTGATCGCAGCAGCTCCTTC -3'
(R):5'- AGACATTTATATATCTTTGTGCGGG -3'

Posted On

2015-12-29