Incidental Mutation 'R4776:Shroom3'
ID367915
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Nameshroom family member 3
SynonymsD5Ertd287e, Shrm3, Shrm
MMRRC Submission 042413-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4776 (G1)
Quality Score149
Status Validated
Chromosome5
Chromosomal Location92683435-92965318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 92943086 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1151 (V1151F)
Ref Sequence ENSEMBL: ENSMUSP00000153516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]
Predicted Effect probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168878
AA Change: V1101F
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172706
SMART Domains Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201800
Predicted Effect probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,719,535 Y683* probably null Het
2610028H24Rik A T 10: 76,457,512 M156L probably benign Het
4930470P17Rik C T 2: 170,579,724 A79T unknown Het
4930522L14Rik A G 5: 109,736,873 I373T probably benign Het
A830010M20Rik C A 5: 107,510,451 A1117E probably damaging Het
Amotl1 G A 9: 14,593,373 Q217* probably null Het
Ankrd28 A T 14: 31,732,054 C254S probably damaging Het
Ap2a1 A G 7: 44,901,546 probably benign Het
Arfgef3 A T 10: 18,654,247 S245T probably benign Het
Arntl A T 7: 113,285,037 K94I probably damaging Het
Atp1b2 A T 11: 69,601,561 D224E probably damaging Het
Boc G A 16: 44,487,721 R924W probably damaging Het
Car14 C T 3: 95,898,873 G292D probably benign Het
Cenpb T C 2: 131,178,183 probably benign Het
Ces1b A T 8: 93,063,030 D423E possibly damaging Het
Cfap54 T A 10: 92,972,694 N1373I possibly damaging Het
Chrdl2 T C 7: 100,006,541 probably benign Het
Cic T G 7: 25,282,883 S12A possibly damaging Het
Csmd2 A T 4: 128,442,892 Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 H120R possibly damaging Het
Dicer1 T A 12: 104,692,446 D1779V probably damaging Het
Dock9 G T 14: 121,610,097 H1016N possibly damaging Het
Dxo T C 17: 34,838,998 L352P probably damaging Het
Eif2b5 T A 16: 20,500,233 F78I probably damaging Het
Eri2 A G 7: 119,784,946 probably benign Het
Fam208b A G 13: 3,570,391 F2170S probably damaging Het
Fbxw7 T G 3: 84,925,689 L13V possibly damaging Het
Fgf7 T A 2: 126,035,783 C23* probably null Het
Fubp1 T A 3: 152,222,068 probably null Het
Gm2663 A T 6: 40,995,953 I240N probably damaging Het
Gnb1l C T 16: 18,548,096 Q140* probably null Het
Gnptab G A 10: 88,436,528 R1010Q probably damaging Het
Gtf2h1 G A 7: 46,822,878 W544* probably null Het
Gucy2c C T 6: 136,722,514 E586K probably damaging Het
Hc T A 2: 35,039,734 E232V probably benign Het
Ifi207 T A 1: 173,730,056 D372V unknown Het
Igkv8-28 A T 6: 70,144,118 V15E probably benign Het
Il1rap A G 16: 26,692,799 S198G possibly damaging Het
Lct A G 1: 128,300,387 I1123T probably damaging Het
Lhcgr T C 17: 88,742,697 E467G probably damaging Het
Macf1 C T 4: 123,476,015 R86K probably benign Het
Maml3 T A 3: 51,856,532 Q337L probably benign Het
March10 T A 11: 105,390,037 D474V probably benign Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mast1 A G 8: 84,937,193 probably null Het
Med12l T C 3: 59,233,212 I868T probably damaging Het
Msrb1 T C 17: 24,740,173 S100P probably damaging Het
Nlrp4c T C 7: 6,066,126 L342P probably benign Het
Nrxn3 T A 12: 90,331,956 V417E possibly damaging Het
Ntng1 T A 3: 109,934,713 D248V probably damaging Het
Oaz3 T C 3: 94,434,998 Q117R probably benign Het
Olfr1311 A G 2: 112,020,931 Y308H probably benign Het
Olfr444 A G 6: 42,955,521 I8V probably benign Het
Olfr589 A G 7: 103,155,414 L111P probably benign Het
Osbpl3 A C 6: 50,300,973 S767A probably benign Het
Pafah1b1 A T 11: 74,685,871 probably benign Het
Pard6b A G 2: 168,098,788 T232A probably damaging Het
Paxip1 A T 5: 27,765,206 C596S probably damaging Het
Pnpla6 T C 8: 3,523,818 V422A probably benign Het
Psmd6 A T 14: 14,120,932 probably benign Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sel1l T A 12: 91,813,893 H658L probably damaging Het
Sh3yl1 T A 12: 30,940,314 L105Q probably damaging Het
Sirt1 T C 10: 63,335,722 K227E probably benign Het
Slc25a34 A T 4: 141,623,588 F37I possibly damaging Het
Slc39a5 T A 10: 128,397,049 I378F probably damaging Het
Smarcad1 A T 6: 65,098,824 D731V probably null Het
Sox6 T G 7: 115,541,670 K483N probably damaging Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srgap1 G T 10: 121,792,351 D882E probably benign Het
Syne4 T C 7: 30,316,833 probably benign Het
Tec T C 5: 72,768,776 Y289C probably benign Het
Tmem102 A T 11: 69,804,802 Y115N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav17 T A 14: 53,806,640 M1K probably null Het
Trdn T A 10: 33,399,082 probably null Het
Trp53 A T 11: 69,586,921 I8F probably benign Het
Ttn T A 2: 76,754,662 D22064V probably damaging Het
Ube3c G A 5: 29,632,838 probably null Het
Ulk1 C T 5: 110,788,947 probably null Het
Upp1 T C 11: 9,135,976 V271A probably damaging Het
Vmn2r4 T C 3: 64,388,661 E901G probably damaging Het
Vmn2r96 G A 17: 18,597,508 G449D probably damaging Het
Vps37b T C 5: 124,006,612 K165E probably damaging Het
Vwf A T 6: 125,566,305 I185F possibly damaging Het
Wasf2 A G 4: 133,185,004 T56A probably benign Het
Zdhhc23 C G 16: 43,973,589 D241H possibly damaging Het
Zfp276 T C 8: 123,254,884 S57P probably benign Het
Zxdc A G 6: 90,370,518 H287R probably damaging Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 92951065 missense probably damaging 1.00
IGL01086:Shroom3 APN 5 92948452 missense probably benign 0.01
IGL01363:Shroom3 APN 5 92940993 missense probably benign 0.01
IGL01468:Shroom3 APN 5 92940342 missense probably damaging 1.00
IGL01675:Shroom3 APN 5 92941680 missense probably damaging 0.99
IGL01862:Shroom3 APN 5 92962289 missense probably damaging 1.00
IGL01987:Shroom3 APN 5 92942189 missense probably damaging 0.99
IGL02104:Shroom3 APN 5 92940389 missense probably benign 0.32
IGL03248:Shroom3 APN 5 92952540 missense probably benign 0.00
IGL03386:Shroom3 APN 5 92948483 splice site probably benign
R0167:Shroom3 UTSW 5 92948395 splice site probably benign
R0388:Shroom3 UTSW 5 92951293 missense probably benign 0.39
R0395:Shroom3 UTSW 5 92780903 missense probably damaging 1.00
R0567:Shroom3 UTSW 5 92964453 missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 92942834 missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 92940656 missense probably damaging 0.97
R1845:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R1921:Shroom3 UTSW 5 92962365 critical splice donor site probably null
R2059:Shroom3 UTSW 5 92683784 missense probably damaging 1.00
R2203:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2204:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2301:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2344:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2345:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2346:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2348:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92780870 missense probably damaging 1.00
R2435:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2829:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2830:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2831:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2897:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2898:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3080:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3433:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3729:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3730:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3735:Shroom3 UTSW 5 92964444 missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 92964444 missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3852:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3943:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3969:Shroom3 UTSW 5 92940879 missense probably benign 0.05
R4008:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4009:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4012:Shroom3 UTSW 5 92948483 splice site probably benign
R4154:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4157:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4172:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4173:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4201:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4202:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4204:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4206:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4284:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4285:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4364:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4384:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4456:Shroom3 UTSW 5 92940999 missense probably benign 0.14
R4707:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4712:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4751:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4755:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4760:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4773:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4774:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4801:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4802:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4856:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4857:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4860:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4860:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4882:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4883:Shroom3 UTSW 5 92951134 missense probably benign 0.14
R4886:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R5262:Shroom3 UTSW 5 92964573 missense probably damaging 1.00
R5271:Shroom3 UTSW 5 92962248 missense probably damaging 1.00
R5719:Shroom3 UTSW 5 92943018 missense probably benign 0.04
R5726:Shroom3 UTSW 5 92943005 missense probably benign 0.00
R5993:Shroom3 UTSW 5 92940188 missense probably damaging 1.00
R6078:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6138:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6153:Shroom3 UTSW 5 92964408 missense probably damaging 0.99
R6493:Shroom3 UTSW 5 92941561 missense probably benign 0.03
R6495:Shroom3 UTSW 5 92942069 missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 92940758 missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 92940936 missense probably damaging 1.00
R6893:Shroom3 UTSW 5 92942204 missense probably damaging 0.97
R6912:Shroom3 UTSW 5 92943017 missense probably benign 0.02
R6924:Shroom3 UTSW 5 92964403 missense probably damaging 1.00
R7083:Shroom3 UTSW 5 92964525 missense probably damaging 1.00
R7197:Shroom3 UTSW 5 92942604 missense probably damaging 1.00
R7366:Shroom3 UTSW 5 92964606 nonsense probably null
R7712:Shroom3 UTSW 5 92950947 missense probably benign 0.01
R7725:Shroom3 UTSW 5 92941653 missense probably benign 0.19
R7728:Shroom3 UTSW 5 92683707 missense possibly damaging 0.73
R7774:Shroom3 UTSW 5 92950489 missense probably damaging 0.98
R7795:Shroom3 UTSW 5 92919649 missense probably damaging 0.99
R7821:Shroom3 UTSW 5 92940846 missense probably damaging 0.98
R7971:Shroom3 UTSW 5 92951074 missense probably damaging 1.00
R8276:Shroom3 UTSW 5 92940480 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGAGCACACTCATCCGTC -3'
(R):5'- TTAACTGTCAGAACGGTAACCAAC -3'

Sequencing Primer
(F):5'- GTGATCGCAGCAGCTCCTTC -3'
(R):5'- AGACATTTATATATCTTTGTGCGGG -3'
Posted On2015-12-29