Incidental Mutation 'R4776:A830010M20Rik'
ID367916
Institutional Source Beutler Lab
Gene Symbol A830010M20Rik
Ensembl Gene ENSMUSG00000111375
Gene NameRIKEN cDNA A830010M20 gene
Synonyms
MMRRC Submission 042413-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4776 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location107437997-107511207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107510451 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 1117 (A1117E)
Ref Sequence ENSEMBL: ENSMUSP00000098511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060553] [ENSMUST00000100951] [ENSMUST00000152474] [ENSMUST00000160160] [ENSMUST00000211896]
Predicted Effect probably benign
Transcript: ENSMUST00000060553
Predicted Effect probably damaging
Transcript: ENSMUST00000100951
AA Change: A1117E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098511
Gene: ENSMUSG00000111375
AA Change: A1117E

DomainStartEndE-ValueType
low complexity region 340 353 N/A INTRINSIC
low complexity region 698 709 N/A INTRINSIC
low complexity region 946 957 N/A INTRINSIC
Pfam:DUF4596 1195 1239 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133800
Predicted Effect probably benign
Transcript: ENSMUST00000143074
SMART Domains Protein: ENSMUSP00000122032
Gene: ENSMUSG00000106631

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152474
SMART Domains Protein: ENSMUSP00000114881
Gene: ENSMUSG00000111375

DomainStartEndE-ValueType
low complexity region 339 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160160
SMART Domains Protein: ENSMUSP00000124398
Gene: ENSMUSG00000106631

DomainStartEndE-ValueType
Pfam:DUF4580 10 140 1.5e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211896
AA Change: A1629E

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1433 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,719,535 Y683* probably null Het
2610028H24Rik A T 10: 76,457,512 M156L probably benign Het
4930470P17Rik C T 2: 170,579,724 A79T unknown Het
4930522L14Rik A G 5: 109,736,873 I373T probably benign Het
Amotl1 G A 9: 14,593,373 Q217* probably null Het
Ankrd28 A T 14: 31,732,054 C254S probably damaging Het
Ap2a1 A G 7: 44,901,546 probably benign Het
Arfgef3 A T 10: 18,654,247 S245T probably benign Het
Arntl A T 7: 113,285,037 K94I probably damaging Het
Atp1b2 A T 11: 69,601,561 D224E probably damaging Het
Boc G A 16: 44,487,721 R924W probably damaging Het
Car14 C T 3: 95,898,873 G292D probably benign Het
Cenpb T C 2: 131,178,183 probably benign Het
Ces1b A T 8: 93,063,030 D423E possibly damaging Het
Cfap54 T A 10: 92,972,694 N1373I possibly damaging Het
Chrdl2 T C 7: 100,006,541 probably benign Het
Cic T G 7: 25,282,883 S12A possibly damaging Het
Csmd2 A T 4: 128,442,892 Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 H120R possibly damaging Het
Dicer1 T A 12: 104,692,446 D1779V probably damaging Het
Dock9 G T 14: 121,610,097 H1016N possibly damaging Het
Dxo T C 17: 34,838,998 L352P probably damaging Het
Eif2b5 T A 16: 20,500,233 F78I probably damaging Het
Eri2 A G 7: 119,784,946 probably benign Het
Fam208b A G 13: 3,570,391 F2170S probably damaging Het
Fbxw7 T G 3: 84,925,689 L13V possibly damaging Het
Fgf7 T A 2: 126,035,783 C23* probably null Het
Fubp1 T A 3: 152,222,068 probably null Het
Gm2663 A T 6: 40,995,953 I240N probably damaging Het
Gnb1l C T 16: 18,548,096 Q140* probably null Het
Gnptab G A 10: 88,436,528 R1010Q probably damaging Het
Gtf2h1 G A 7: 46,822,878 W544* probably null Het
Gucy2c C T 6: 136,722,514 E586K probably damaging Het
Hc T A 2: 35,039,734 E232V probably benign Het
Ifi207 T A 1: 173,730,056 D372V unknown Het
Igkv8-28 A T 6: 70,144,118 V15E probably benign Het
Il1rap A G 16: 26,692,799 S198G possibly damaging Het
Lct A G 1: 128,300,387 I1123T probably damaging Het
Lhcgr T C 17: 88,742,697 E467G probably damaging Het
Macf1 C T 4: 123,476,015 R86K probably benign Het
Maml3 T A 3: 51,856,532 Q337L probably benign Het
March10 T A 11: 105,390,037 D474V probably benign Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mast1 A G 8: 84,937,193 probably null Het
Med12l T C 3: 59,233,212 I868T probably damaging Het
Msrb1 T C 17: 24,740,173 S100P probably damaging Het
Nlrp4c T C 7: 6,066,126 L342P probably benign Het
Nrxn3 T A 12: 90,331,956 V417E possibly damaging Het
Ntng1 T A 3: 109,934,713 D248V probably damaging Het
Oaz3 T C 3: 94,434,998 Q117R probably benign Het
Olfr1311 A G 2: 112,020,931 Y308H probably benign Het
Olfr444 A G 6: 42,955,521 I8V probably benign Het
Olfr589 A G 7: 103,155,414 L111P probably benign Het
Osbpl3 A C 6: 50,300,973 S767A probably benign Het
Pafah1b1 A T 11: 74,685,871 probably benign Het
Pard6b A G 2: 168,098,788 T232A probably damaging Het
Paxip1 A T 5: 27,765,206 C596S probably damaging Het
Pnpla6 T C 8: 3,523,818 V422A probably benign Het
Psmd6 A T 14: 14,120,932 probably benign Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sel1l T A 12: 91,813,893 H658L probably damaging Het
Sh3yl1 T A 12: 30,940,314 L105Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sirt1 T C 10: 63,335,722 K227E probably benign Het
Slc25a34 A T 4: 141,623,588 F37I possibly damaging Het
Slc39a5 T A 10: 128,397,049 I378F probably damaging Het
Smarcad1 A T 6: 65,098,824 D731V probably null Het
Sox6 T G 7: 115,541,670 K483N probably damaging Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srgap1 G T 10: 121,792,351 D882E probably benign Het
Syne4 T C 7: 30,316,833 probably benign Het
Tec T C 5: 72,768,776 Y289C probably benign Het
Tmem102 A T 11: 69,804,802 Y115N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav17 T A 14: 53,806,640 M1K probably null Het
Trdn T A 10: 33,399,082 probably null Het
Trp53 A T 11: 69,586,921 I8F probably benign Het
Ttn T A 2: 76,754,662 D22064V probably damaging Het
Ube3c G A 5: 29,632,838 probably null Het
Ulk1 C T 5: 110,788,947 probably null Het
Upp1 T C 11: 9,135,976 V271A probably damaging Het
Vmn2r4 T C 3: 64,388,661 E901G probably damaging Het
Vmn2r96 G A 17: 18,597,508 G449D probably damaging Het
Vps37b T C 5: 124,006,612 K165E probably damaging Het
Vwf A T 6: 125,566,305 I185F possibly damaging Het
Wasf2 A G 4: 133,185,004 T56A probably benign Het
Zdhhc23 C G 16: 43,973,589 D241H possibly damaging Het
Zfp276 T C 8: 123,254,884 S57P probably benign Het
Zxdc A G 6: 90,370,518 H287R probably damaging Het
Other mutations in A830010M20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01911:A830010M20Rik APN 5 107508580 missense probably damaging 1.00
IGL02638:A830010M20Rik APN 5 107508556 missense possibly damaging 0.87
IGL03001:A830010M20Rik APN 5 107497842 missense probably damaging 1.00
IGL03007:A830010M20Rik APN 5 107503676 missense probably benign 0.37
IGL03008:A830010M20Rik APN 5 107491598 splice site probably null
IGL03281:A830010M20Rik APN 5 107503876 missense probably benign 0.02
R0206:A830010M20Rik UTSW 5 107505040 missense probably benign 0.00
R0426:A830010M20Rik UTSW 5 107510373 missense probably damaging 1.00
R0765:A830010M20Rik UTSW 5 107506934 missense probably benign 0.14
R1747:A830010M20Rik UTSW 5 107451999 missense probably damaging 1.00
R2013:A830010M20Rik UTSW 5 107510789 missense probably damaging 0.99
R2338:A830010M20Rik UTSW 5 107510574 missense probably damaging 0.99
R3963:A830010M20Rik UTSW 5 107507356 missense probably damaging 0.99
R4460:A830010M20Rik UTSW 5 107503765 missense possibly damaging 0.74
R4909:A830010M20Rik UTSW 5 107507310 nonsense probably null
R5105:A830010M20Rik UTSW 5 107510471 missense possibly damaging 0.70
R5155:A830010M20Rik UTSW 5 107490703 missense probably damaging 0.96
R6089:A830010M20Rik UTSW 5 107507029 missense probably damaging 0.99
R7282:A830010M20Rik UTSW 5 107507196 missense probably benign
R7282:A830010M20Rik UTSW 5 107510505 missense probably damaging 0.99
R7492:A830010M20Rik UTSW 5 107510507 missense probably benign 0.01
R8087:A830010M20Rik UTSW 5 107485087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAAGCTAATACTGCTATGTTGTG -3'
(R):5'- TCTCGAGCTAAGAGGAGTGTC -3'

Sequencing Primer
(F):5'- ACTGCTATGTTGTGTTAATGTTGTTC -3'
(R):5'- CTGGTTGATTAAATACTGGGCTAAGC -3'
Posted On2015-12-29