Incidental Mutation 'R4776:Smarcad1'
ID 367922
Institutional Source Beutler Lab
Gene Symbol Smarcad1
Ensembl Gene ENSMUSG00000029920
Gene Name SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1
Synonyms Etl1, D6Pas1
MMRRC Submission 042413-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R4776 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 65019577-65093045 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 65075808 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 731 (D731V)
Ref Sequence ENSEMBL: ENSMUSP00000031984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031984] [ENSMUST00000204620]
AlphaFold Q04692
Predicted Effect probably null
Transcript: ENSMUST00000031984
AA Change: D731V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031984
Gene: ENSMUSG00000029920
AA Change: D731V

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
low complexity region 143 156 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 488 682 2.58e-38 SMART
Blast:DEXDc 685 745 4e-16 BLAST
HELICc 879 962 4.58e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204170
Predicted Effect probably benign
Transcript: ENSMUST00000204620
SMART Domains Protein: ENSMUSP00000144767
Gene: ENSMUSG00000029920

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Meta Mutation Damage Score 0.7324 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SNF subfamily of helicase proteins. The encoded protein plays a critical role in the restoration of heterochromatin organization and propagation of epigenetic patterns following DNA replication by mediating histone H3/H4 deacetylation. Mutations in this gene are associated with adermatoglyphia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded growth, impaired fertility, skeletal dysplasias, and peri- and postnatal lethality. Mutant phenotypes are influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(258) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(256)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,293,346 (GRCm39) M156L probably benign Het
4930470P17Rik C T 2: 170,421,644 (GRCm39) A79T unknown Het
4930522L14Rik A G 5: 109,884,739 (GRCm39) I373T probably benign Het
Amotl1 G A 9: 14,504,669 (GRCm39) Q217* probably null Het
Ankrd28 A T 14: 31,454,011 (GRCm39) C254S probably damaging Het
Ap2a1 A G 7: 44,550,970 (GRCm39) probably benign Het
Arfgef3 A T 10: 18,529,995 (GRCm39) S245T probably benign Het
Atp1b2 A T 11: 69,492,387 (GRCm39) D224E probably damaging Het
Bmal1 A T 7: 112,884,244 (GRCm39) K94I probably damaging Het
Boc G A 16: 44,308,084 (GRCm39) R924W probably damaging Het
Btbd8 C A 5: 107,658,317 (GRCm39) A1117E probably damaging Het
Car14 C T 3: 95,806,185 (GRCm39) G292D probably benign Het
Cenpb T C 2: 131,020,103 (GRCm39) probably benign Het
Ces1b A T 8: 93,789,658 (GRCm39) D423E possibly damaging Het
Cfap54 T A 10: 92,808,556 (GRCm39) N1373I possibly damaging Het
Chrdl2 T C 7: 99,655,748 (GRCm39) probably benign Het
Cic T G 7: 24,982,308 (GRCm39) S12A possibly damaging Het
Csmd2 A T 4: 128,336,685 (GRCm39) Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 (GRCm39) H120R possibly damaging Het
Dicer1 T A 12: 104,658,705 (GRCm39) D1779V probably damaging Het
Dock9 G T 14: 121,847,509 (GRCm39) H1016N possibly damaging Het
Dxo T C 17: 35,057,974 (GRCm39) L352P probably damaging Het
Eif2b5 T A 16: 20,318,983 (GRCm39) F78I probably damaging Het
Eri2 A G 7: 119,384,169 (GRCm39) probably benign Het
Fbxw7 T G 3: 84,832,996 (GRCm39) L13V possibly damaging Het
Fgf7 T A 2: 125,877,703 (GRCm39) C23* probably null Het
Fubp1 T A 3: 151,927,705 (GRCm39) probably null Het
Gm2663 A T 6: 40,972,887 (GRCm39) I240N probably damaging Het
Gnb1l C T 16: 18,366,846 (GRCm39) Q140* probably null Het
Gnptab G A 10: 88,272,390 (GRCm39) R1010Q probably damaging Het
Gtf2h1 G A 7: 46,472,302 (GRCm39) W544* probably null Het
Gucy2c C T 6: 136,699,512 (GRCm39) E586K probably damaging Het
Hc T A 2: 34,929,746 (GRCm39) E232V probably benign Het
Ifi207 T A 1: 173,557,622 (GRCm39) D372V unknown Het
Igkv8-28 A T 6: 70,121,102 (GRCm39) V15E probably benign Het
Il1rap A G 16: 26,511,549 (GRCm39) S198G possibly damaging Het
Lct A G 1: 128,228,124 (GRCm39) I1123T probably damaging Het
Lhcgr T C 17: 89,050,125 (GRCm39) E467G probably damaging Het
Macf1 C T 4: 123,369,808 (GRCm39) R86K probably benign Het
Maml3 T A 3: 51,763,953 (GRCm39) Q337L probably benign Het
Marchf10 T A 11: 105,280,863 (GRCm39) D474V probably benign Het
Marchf2 G T 17: 33,928,890 (GRCm39) T2K probably damaging Het
Mast1 A G 8: 85,663,822 (GRCm39) probably null Het
Med12l T C 3: 59,140,633 (GRCm39) I868T probably damaging Het
Msrb1 T C 17: 24,959,147 (GRCm39) S100P probably damaging Het
Nlrp4c T C 7: 6,069,125 (GRCm39) L342P probably benign Het
Nrxn3 T A 12: 90,298,730 (GRCm39) V417E possibly damaging Het
Ntng1 T A 3: 109,842,029 (GRCm39) D248V probably damaging Het
Oaz3 T C 3: 94,342,305 (GRCm39) Q117R probably benign Het
Or2a56 A G 6: 42,932,455 (GRCm39) I8V probably benign Het
Or4f58 A G 2: 111,851,276 (GRCm39) Y308H probably benign Het
Or52e2 A G 7: 102,804,621 (GRCm39) L111P probably benign Het
Osbpl3 A C 6: 50,277,953 (GRCm39) S767A probably benign Het
Pafah1b1 A T 11: 74,576,697 (GRCm39) probably benign Het
Pard6b A G 2: 167,940,708 (GRCm39) T232A probably damaging Het
Paxip1 A T 5: 27,970,204 (GRCm39) C596S probably damaging Het
Pnpla6 T C 8: 3,573,818 (GRCm39) V422A probably benign Het
Psmd6 A T 14: 14,120,932 (GRCm38) probably benign Het
Relch T A 1: 105,647,260 (GRCm39) Y683* probably null Het
Rock2 T A 12: 17,027,741 (GRCm39) C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Sel1l T A 12: 91,780,667 (GRCm39) H658L probably damaging Het
Sh3yl1 T A 12: 30,990,313 (GRCm39) L105Q probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sirt1 T C 10: 63,171,501 (GRCm39) K227E probably benign Het
Slc25a34 A T 4: 141,350,899 (GRCm39) F37I possibly damaging Het
Slc39a5 T A 10: 128,232,918 (GRCm39) I378F probably damaging Het
Sox6 T G 7: 115,140,905 (GRCm39) K483N probably damaging Het
Sp140 T A 1: 85,538,549 (GRCm39) D95E possibly damaging Het
Srgap1 G T 10: 121,628,256 (GRCm39) D882E probably benign Het
Syne4 T C 7: 30,016,258 (GRCm39) probably benign Het
Tasor2 A G 13: 3,620,391 (GRCm39) F2170S probably damaging Het
Tec T C 5: 72,926,119 (GRCm39) Y289C probably benign Het
Tmem102 A T 11: 69,695,628 (GRCm39) Y115N probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trav17 T A 14: 54,044,097 (GRCm39) M1K probably null Het
Trdn T A 10: 33,275,078 (GRCm39) probably null Het
Trp53 A T 11: 69,477,747 (GRCm39) I8F probably benign Het
Ttn T A 2: 76,585,006 (GRCm39) D22064V probably damaging Het
Ube3c G A 5: 29,837,836 (GRCm39) probably null Het
Ulk1 C T 5: 110,936,813 (GRCm39) probably null Het
Upp1 T C 11: 9,085,976 (GRCm39) V271A probably damaging Het
Vmn2r4 T C 3: 64,296,082 (GRCm39) E901G probably damaging Het
Vmn2r96 G A 17: 18,817,770 (GRCm39) G449D probably damaging Het
Vps37b T C 5: 124,144,675 (GRCm39) K165E probably damaging Het
Vwf A T 6: 125,543,268 (GRCm39) I185F possibly damaging Het
Wasf2 A G 4: 132,912,315 (GRCm39) T56A probably benign Het
Zdhhc23 C G 16: 43,793,952 (GRCm39) D241H possibly damaging Het
Zfp276 T C 8: 123,981,623 (GRCm39) S57P probably benign Het
Zxdc A G 6: 90,347,500 (GRCm39) H287R probably damaging Het
Other mutations in Smarcad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Smarcad1 APN 6 65,050,223 (GRCm39) missense probably damaging 1.00
IGL02707:Smarcad1 APN 6 65,029,790 (GRCm39) unclassified probably benign
IGL03006:Smarcad1 APN 6 65,060,873 (GRCm39) missense probably benign 0.01
IGL03131:Smarcad1 APN 6 65,051,937 (GRCm39) missense probably damaging 0.96
IGL03406:Smarcad1 APN 6 65,069,510 (GRCm39) missense probably damaging 0.98
Trollip UTSW 6 65,091,320 (GRCm39) missense probably damaging 1.00
wastrel UTSW 6 65,029,654 (GRCm39) missense probably damaging 1.00
N/A - 293:Smarcad1 UTSW 6 65,051,898 (GRCm39) missense probably benign 0.06
R0020:Smarcad1 UTSW 6 65,060,991 (GRCm39) splice site probably benign
R0452:Smarcad1 UTSW 6 65,051,806 (GRCm39) missense possibly damaging 0.66
R1005:Smarcad1 UTSW 6 65,085,711 (GRCm39) missense probably benign 0.30
R1143:Smarcad1 UTSW 6 65,073,678 (GRCm39) missense probably benign 0.02
R1624:Smarcad1 UTSW 6 65,029,631 (GRCm39) missense probably benign 0.40
R1629:Smarcad1 UTSW 6 65,044,091 (GRCm39) missense probably benign 0.00
R1705:Smarcad1 UTSW 6 65,033,400 (GRCm39) missense probably damaging 1.00
R2000:Smarcad1 UTSW 6 65,050,200 (GRCm39) missense probably damaging 1.00
R2979:Smarcad1 UTSW 6 65,051,995 (GRCm39) missense probably benign 0.00
R3937:Smarcad1 UTSW 6 65,091,320 (GRCm39) missense probably damaging 1.00
R4391:Smarcad1 UTSW 6 65,033,443 (GRCm39) missense probably benign 0.17
R4648:Smarcad1 UTSW 6 65,044,073 (GRCm39) missense probably benign 0.04
R4697:Smarcad1 UTSW 6 65,029,625 (GRCm39) missense probably benign 0.00
R4709:Smarcad1 UTSW 6 65,052,099 (GRCm39) missense probably benign 0.01
R4726:Smarcad1 UTSW 6 65,052,025 (GRCm39) missense probably damaging 1.00
R4928:Smarcad1 UTSW 6 65,051,898 (GRCm39) missense probably benign 0.06
R5619:Smarcad1 UTSW 6 65,088,865 (GRCm39) missense probably benign 0.03
R5709:Smarcad1 UTSW 6 65,051,746 (GRCm39) missense probably benign 0.01
R6038:Smarcad1 UTSW 6 65,050,232 (GRCm39) missense possibly damaging 0.91
R6038:Smarcad1 UTSW 6 65,050,232 (GRCm39) missense possibly damaging 0.91
R6220:Smarcad1 UTSW 6 65,091,313 (GRCm39) missense probably benign 0.09
R6302:Smarcad1 UTSW 6 65,052,122 (GRCm39) missense possibly damaging 0.93
R7014:Smarcad1 UTSW 6 65,029,654 (GRCm39) missense probably damaging 1.00
R7149:Smarcad1 UTSW 6 65,029,716 (GRCm39) missense probably benign 0.11
R7378:Smarcad1 UTSW 6 65,087,360 (GRCm39) missense probably benign 0.16
R7569:Smarcad1 UTSW 6 65,029,695 (GRCm39) missense probably benign 0.11
R7626:Smarcad1 UTSW 6 65,073,033 (GRCm39) missense possibly damaging 0.71
R7774:Smarcad1 UTSW 6 65,084,814 (GRCm39) missense probably damaging 1.00
R8079:Smarcad1 UTSW 6 65,029,766 (GRCm39) missense possibly damaging 0.51
R8119:Smarcad1 UTSW 6 65,071,303 (GRCm39) missense probably benign
R8129:Smarcad1 UTSW 6 65,044,078 (GRCm39) missense probably benign 0.09
R8558:Smarcad1 UTSW 6 65,060,908 (GRCm39) missense probably benign 0.09
R8679:Smarcad1 UTSW 6 65,088,865 (GRCm39) missense probably benign 0.03
R8770:Smarcad1 UTSW 6 65,029,718 (GRCm39) missense probably benign
R8795:Smarcad1 UTSW 6 65,049,033 (GRCm39) missense probably benign 0.10
R9104:Smarcad1 UTSW 6 65,075,649 (GRCm39) missense probably benign 0.06
R9133:Smarcad1 UTSW 6 65,049,035 (GRCm39) missense probably damaging 0.99
R9400:Smarcad1 UTSW 6 65,050,214 (GRCm39) missense probably damaging 0.97
R9401:Smarcad1 UTSW 6 65,071,321 (GRCm39) missense probably benign 0.00
R9608:Smarcad1 UTSW 6 65,091,318 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGAAACCAGCAGACGAGC -3'
(R):5'- TGCATCATGACATTGCACATCTC -3'

Sequencing Primer
(F):5'- CCAGCAGACGAGCAGAGTATATAC -3'
(R):5'- TCTACAGAGTGAGTTCCAGGAC -3'
Posted On 2015-12-29