Incidental Mutation 'R4776:Zxdc'
ID 367923
Institutional Source Beutler Lab
Gene Symbol Zxdc
Ensembl Gene ENSMUSG00000034430
Gene Name ZXD family zinc finger C
Synonyms B930086F11Rik
MMRRC Submission 042413-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R4776 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 90346474-90380472 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90347500 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 287 (H287R)
Ref Sequence ENSEMBL: ENSMUSP00000109167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045740] [ENSMUST00000075117] [ENSMUST00000113539]
AlphaFold Q8C8V1
Predicted Effect probably damaging
Transcript: ENSMUST00000045740
AA Change: H287R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036329
Gene: ENSMUSG00000034430
AA Change: H287R

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075117
AA Change: H287R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074619
Gene: ENSMUSG00000034430
AA Change: H287R

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
low complexity region 799 811 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113539
AA Change: H287R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109167
Gene: ENSMUSG00000034430
AA Change: H287R

DomainStartEndE-ValueType
low complexity region 44 95 N/A INTRINSIC
low complexity region 127 137 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
ZnF_C2H2 198 222 4.79e-3 SMART
ZnF_C2H2 231 255 4.3e-5 SMART
ZnF_C2H2 261 285 4.3e-5 SMART
ZnF_C2H2 291 313 1.69e-3 SMART
ZnF_C2H2 320 344 1.82e-3 SMART
ZnF_C2H2 351 375 1.26e-2 SMART
ZnF_C2H2 381 405 1.36e-2 SMART
ZnF_C2H2 411 435 5.21e-4 SMART
ZnF_C2H2 441 465 4.72e-2 SMART
ZnF_C2H2 474 499 3.07e-1 SMART
low complexity region 509 524 N/A INTRINSIC
low complexity region 657 673 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137483
Predicted Effect probably benign
Transcript: ENSMUST00000203493
Meta Mutation Damage Score 0.7765 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,293,346 (GRCm39) M156L probably benign Het
4930470P17Rik C T 2: 170,421,644 (GRCm39) A79T unknown Het
4930522L14Rik A G 5: 109,884,739 (GRCm39) I373T probably benign Het
Amotl1 G A 9: 14,504,669 (GRCm39) Q217* probably null Het
Ankrd28 A T 14: 31,454,011 (GRCm39) C254S probably damaging Het
Ap2a1 A G 7: 44,550,970 (GRCm39) probably benign Het
Arfgef3 A T 10: 18,529,995 (GRCm39) S245T probably benign Het
Atp1b2 A T 11: 69,492,387 (GRCm39) D224E probably damaging Het
Bmal1 A T 7: 112,884,244 (GRCm39) K94I probably damaging Het
Boc G A 16: 44,308,084 (GRCm39) R924W probably damaging Het
Btbd8 C A 5: 107,658,317 (GRCm39) A1117E probably damaging Het
Car14 C T 3: 95,806,185 (GRCm39) G292D probably benign Het
Cenpb T C 2: 131,020,103 (GRCm39) probably benign Het
Ces1b A T 8: 93,789,658 (GRCm39) D423E possibly damaging Het
Cfap54 T A 10: 92,808,556 (GRCm39) N1373I possibly damaging Het
Chrdl2 T C 7: 99,655,748 (GRCm39) probably benign Het
Cic T G 7: 24,982,308 (GRCm39) S12A possibly damaging Het
Csmd2 A T 4: 128,336,685 (GRCm39) Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 (GRCm39) H120R possibly damaging Het
Dicer1 T A 12: 104,658,705 (GRCm39) D1779V probably damaging Het
Dock9 G T 14: 121,847,509 (GRCm39) H1016N possibly damaging Het
Dxo T C 17: 35,057,974 (GRCm39) L352P probably damaging Het
Eif2b5 T A 16: 20,318,983 (GRCm39) F78I probably damaging Het
Eri2 A G 7: 119,384,169 (GRCm39) probably benign Het
Fbxw7 T G 3: 84,832,996 (GRCm39) L13V possibly damaging Het
Fgf7 T A 2: 125,877,703 (GRCm39) C23* probably null Het
Fubp1 T A 3: 151,927,705 (GRCm39) probably null Het
Gm2663 A T 6: 40,972,887 (GRCm39) I240N probably damaging Het
Gnb1l C T 16: 18,366,846 (GRCm39) Q140* probably null Het
Gnptab G A 10: 88,272,390 (GRCm39) R1010Q probably damaging Het
Gtf2h1 G A 7: 46,472,302 (GRCm39) W544* probably null Het
Gucy2c C T 6: 136,699,512 (GRCm39) E586K probably damaging Het
Hc T A 2: 34,929,746 (GRCm39) E232V probably benign Het
Ifi207 T A 1: 173,557,622 (GRCm39) D372V unknown Het
Igkv8-28 A T 6: 70,121,102 (GRCm39) V15E probably benign Het
Il1rap A G 16: 26,511,549 (GRCm39) S198G possibly damaging Het
Lct A G 1: 128,228,124 (GRCm39) I1123T probably damaging Het
Lhcgr T C 17: 89,050,125 (GRCm39) E467G probably damaging Het
Macf1 C T 4: 123,369,808 (GRCm39) R86K probably benign Het
Maml3 T A 3: 51,763,953 (GRCm39) Q337L probably benign Het
Marchf10 T A 11: 105,280,863 (GRCm39) D474V probably benign Het
Marchf2 G T 17: 33,928,890 (GRCm39) T2K probably damaging Het
Mast1 A G 8: 85,663,822 (GRCm39) probably null Het
Med12l T C 3: 59,140,633 (GRCm39) I868T probably damaging Het
Msrb1 T C 17: 24,959,147 (GRCm39) S100P probably damaging Het
Nlrp4c T C 7: 6,069,125 (GRCm39) L342P probably benign Het
Nrxn3 T A 12: 90,298,730 (GRCm39) V417E possibly damaging Het
Ntng1 T A 3: 109,842,029 (GRCm39) D248V probably damaging Het
Oaz3 T C 3: 94,342,305 (GRCm39) Q117R probably benign Het
Or2a56 A G 6: 42,932,455 (GRCm39) I8V probably benign Het
Or4f58 A G 2: 111,851,276 (GRCm39) Y308H probably benign Het
Or52e2 A G 7: 102,804,621 (GRCm39) L111P probably benign Het
Osbpl3 A C 6: 50,277,953 (GRCm39) S767A probably benign Het
Pafah1b1 A T 11: 74,576,697 (GRCm39) probably benign Het
Pard6b A G 2: 167,940,708 (GRCm39) T232A probably damaging Het
Paxip1 A T 5: 27,970,204 (GRCm39) C596S probably damaging Het
Pnpla6 T C 8: 3,573,818 (GRCm39) V422A probably benign Het
Psmd6 A T 14: 14,120,932 (GRCm38) probably benign Het
Relch T A 1: 105,647,260 (GRCm39) Y683* probably null Het
Rock2 T A 12: 17,027,741 (GRCm39) C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Sel1l T A 12: 91,780,667 (GRCm39) H658L probably damaging Het
Sh3yl1 T A 12: 30,990,313 (GRCm39) L105Q probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sirt1 T C 10: 63,171,501 (GRCm39) K227E probably benign Het
Slc25a34 A T 4: 141,350,899 (GRCm39) F37I possibly damaging Het
Slc39a5 T A 10: 128,232,918 (GRCm39) I378F probably damaging Het
Smarcad1 A T 6: 65,075,808 (GRCm39) D731V probably null Het
Sox6 T G 7: 115,140,905 (GRCm39) K483N probably damaging Het
Sp140 T A 1: 85,538,549 (GRCm39) D95E possibly damaging Het
Srgap1 G T 10: 121,628,256 (GRCm39) D882E probably benign Het
Syne4 T C 7: 30,016,258 (GRCm39) probably benign Het
Tasor2 A G 13: 3,620,391 (GRCm39) F2170S probably damaging Het
Tec T C 5: 72,926,119 (GRCm39) Y289C probably benign Het
Tmem102 A T 11: 69,695,628 (GRCm39) Y115N probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trav17 T A 14: 54,044,097 (GRCm39) M1K probably null Het
Trdn T A 10: 33,275,078 (GRCm39) probably null Het
Trp53 A T 11: 69,477,747 (GRCm39) I8F probably benign Het
Ttn T A 2: 76,585,006 (GRCm39) D22064V probably damaging Het
Ube3c G A 5: 29,837,836 (GRCm39) probably null Het
Ulk1 C T 5: 110,936,813 (GRCm39) probably null Het
Upp1 T C 11: 9,085,976 (GRCm39) V271A probably damaging Het
Vmn2r4 T C 3: 64,296,082 (GRCm39) E901G probably damaging Het
Vmn2r96 G A 17: 18,817,770 (GRCm39) G449D probably damaging Het
Vps37b T C 5: 124,144,675 (GRCm39) K165E probably damaging Het
Vwf A T 6: 125,543,268 (GRCm39) I185F possibly damaging Het
Wasf2 A G 4: 132,912,315 (GRCm39) T56A probably benign Het
Zdhhc23 C G 16: 43,793,952 (GRCm39) D241H possibly damaging Het
Zfp276 T C 8: 123,981,623 (GRCm39) S57P probably benign Het
Other mutations in Zxdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Zxdc APN 6 90,350,761 (GRCm39) missense probably damaging 1.00
IGL01943:Zxdc APN 6 90,349,520 (GRCm39) intron probably benign
IGL02406:Zxdc APN 6 90,375,818 (GRCm39) missense probably benign 0.00
IGL02596:Zxdc APN 6 90,350,691 (GRCm39) critical splice acceptor site probably null
IGL02623:Zxdc APN 6 90,359,352 (GRCm39) missense probably damaging 0.99
IGL02927:Zxdc APN 6 90,349,544 (GRCm39) missense probably damaging 1.00
IGL03230:Zxdc APN 6 90,350,785 (GRCm39) missense probably damaging 1.00
PIT4378001:Zxdc UTSW 6 90,350,698 (GRCm39) missense probably damaging 1.00
R0071:Zxdc UTSW 6 90,347,398 (GRCm39) missense probably damaging 1.00
R0194:Zxdc UTSW 6 90,349,519 (GRCm39) intron probably benign
R1065:Zxdc UTSW 6 90,355,885 (GRCm39) missense probably damaging 1.00
R1377:Zxdc UTSW 6 90,355,885 (GRCm39) missense probably damaging 1.00
R1405:Zxdc UTSW 6 90,361,225 (GRCm39) missense possibly damaging 0.50
R1405:Zxdc UTSW 6 90,361,225 (GRCm39) missense possibly damaging 0.50
R1692:Zxdc UTSW 6 90,355,933 (GRCm39) nonsense probably null
R2171:Zxdc UTSW 6 90,359,461 (GRCm39) missense possibly damaging 0.53
R3952:Zxdc UTSW 6 90,347,449 (GRCm39) splice site probably null
R4400:Zxdc UTSW 6 90,346,792 (GRCm39) missense probably damaging 1.00
R4660:Zxdc UTSW 6 90,355,820 (GRCm39) missense probably damaging 0.99
R4781:Zxdc UTSW 6 90,349,535 (GRCm39) missense probably damaging 0.98
R4843:Zxdc UTSW 6 90,359,254 (GRCm39) missense probably damaging 1.00
R5028:Zxdc UTSW 6 90,359,320 (GRCm39) missense probably benign 0.44
R5260:Zxdc UTSW 6 90,359,075 (GRCm39) missense probably damaging 1.00
R5279:Zxdc UTSW 6 90,347,419 (GRCm39) missense possibly damaging 0.86
R5324:Zxdc UTSW 6 90,350,782 (GRCm39) missense probably damaging 1.00
R5363:Zxdc UTSW 6 90,359,128 (GRCm39) missense probably damaging 0.97
R5436:Zxdc UTSW 6 90,347,542 (GRCm39) missense probably damaging 0.99
R5872:Zxdc UTSW 6 90,347,281 (GRCm39) missense probably damaging 0.99
R5940:Zxdc UTSW 6 90,347,307 (GRCm39) missense probably damaging 1.00
R6762:Zxdc UTSW 6 90,359,165 (GRCm39) missense probably benign
R7175:Zxdc UTSW 6 90,346,645 (GRCm39) missense possibly damaging 0.85
R7197:Zxdc UTSW 6 90,355,819 (GRCm39) missense probably damaging 0.99
R7238:Zxdc UTSW 6 90,346,642 (GRCm39) missense unknown
R7247:Zxdc UTSW 6 90,361,155 (GRCm39) missense unknown
R7917:Zxdc UTSW 6 90,358,991 (GRCm39) missense probably damaging 1.00
R7976:Zxdc UTSW 6 90,375,749 (GRCm39) missense probably benign 0.05
R8792:Zxdc UTSW 6 90,346,986 (GRCm39) missense probably benign 0.00
R8917:Zxdc UTSW 6 90,359,305 (GRCm39) missense probably benign 0.00
R9016:Zxdc UTSW 6 90,359,254 (GRCm39) missense probably damaging 1.00
R9076:Zxdc UTSW 6 90,349,821 (GRCm39) missense probably damaging 1.00
R9190:Zxdc UTSW 6 90,375,773 (GRCm39) missense probably damaging 0.96
R9216:Zxdc UTSW 6 90,359,189 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TCGCCAAGAAGCACCAGTTG -3'
(R):5'- CTCATTTAGATCAGGGCGCG -3'

Sequencing Primer
(F):5'- ACCAGTTGAAGGTGCACC -3'
(R):5'- GTAACGCCTCCACCCCG -3'
Posted On 2015-12-29