Incidental Mutation 'R4776:Nlrp4c'
ID 367927
Institutional Source Beutler Lab
Gene Symbol Nlrp4c
Ensembl Gene ENSMUSG00000034690
Gene Name NLR family, pyrin domain containing 4C
Synonyms Nalp4c, Nalp-alpha, Rnh2
MMRRC Submission 042413-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R4776 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 6048160-6108148 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6069125 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 342 (L342P)
Ref Sequence ENSEMBL: ENSMUSP00000146613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037728] [ENSMUST00000121583] [ENSMUST00000208360]
AlphaFold Q3TKR3
Predicted Effect probably benign
Transcript: ENSMUST00000037728
AA Change: L342P

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046503
Gene: ENSMUSG00000034690
AA Change: L342P

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 4.5e-40 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121583
AA Change: L342P

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113824
Gene: ENSMUSG00000034690
AA Change: L342P

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 1.7e-39 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207267
Predicted Effect probably benign
Transcript: ENSMUST00000208360
AA Change: L342P

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.5208 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,293,346 (GRCm39) M156L probably benign Het
4930470P17Rik C T 2: 170,421,644 (GRCm39) A79T unknown Het
4930522L14Rik A G 5: 109,884,739 (GRCm39) I373T probably benign Het
Amotl1 G A 9: 14,504,669 (GRCm39) Q217* probably null Het
Ankrd28 A T 14: 31,454,011 (GRCm39) C254S probably damaging Het
Ap2a1 A G 7: 44,550,970 (GRCm39) probably benign Het
Arfgef3 A T 10: 18,529,995 (GRCm39) S245T probably benign Het
Atp1b2 A T 11: 69,492,387 (GRCm39) D224E probably damaging Het
Bmal1 A T 7: 112,884,244 (GRCm39) K94I probably damaging Het
Boc G A 16: 44,308,084 (GRCm39) R924W probably damaging Het
Btbd8 C A 5: 107,658,317 (GRCm39) A1117E probably damaging Het
Car14 C T 3: 95,806,185 (GRCm39) G292D probably benign Het
Cenpb T C 2: 131,020,103 (GRCm39) probably benign Het
Ces1b A T 8: 93,789,658 (GRCm39) D423E possibly damaging Het
Cfap54 T A 10: 92,808,556 (GRCm39) N1373I possibly damaging Het
Chrdl2 T C 7: 99,655,748 (GRCm39) probably benign Het
Cic T G 7: 24,982,308 (GRCm39) S12A possibly damaging Het
Csmd2 A T 4: 128,336,685 (GRCm39) Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 (GRCm39) H120R possibly damaging Het
Dicer1 T A 12: 104,658,705 (GRCm39) D1779V probably damaging Het
Dock9 G T 14: 121,847,509 (GRCm39) H1016N possibly damaging Het
Dxo T C 17: 35,057,974 (GRCm39) L352P probably damaging Het
Eif2b5 T A 16: 20,318,983 (GRCm39) F78I probably damaging Het
Eri2 A G 7: 119,384,169 (GRCm39) probably benign Het
Fbxw7 T G 3: 84,832,996 (GRCm39) L13V possibly damaging Het
Fgf7 T A 2: 125,877,703 (GRCm39) C23* probably null Het
Fubp1 T A 3: 151,927,705 (GRCm39) probably null Het
Gm2663 A T 6: 40,972,887 (GRCm39) I240N probably damaging Het
Gnb1l C T 16: 18,366,846 (GRCm39) Q140* probably null Het
Gnptab G A 10: 88,272,390 (GRCm39) R1010Q probably damaging Het
Gtf2h1 G A 7: 46,472,302 (GRCm39) W544* probably null Het
Gucy2c C T 6: 136,699,512 (GRCm39) E586K probably damaging Het
Hc T A 2: 34,929,746 (GRCm39) E232V probably benign Het
Ifi207 T A 1: 173,557,622 (GRCm39) D372V unknown Het
Igkv8-28 A T 6: 70,121,102 (GRCm39) V15E probably benign Het
Il1rap A G 16: 26,511,549 (GRCm39) S198G possibly damaging Het
Lct A G 1: 128,228,124 (GRCm39) I1123T probably damaging Het
Lhcgr T C 17: 89,050,125 (GRCm39) E467G probably damaging Het
Macf1 C T 4: 123,369,808 (GRCm39) R86K probably benign Het
Maml3 T A 3: 51,763,953 (GRCm39) Q337L probably benign Het
Marchf10 T A 11: 105,280,863 (GRCm39) D474V probably benign Het
Marchf2 G T 17: 33,928,890 (GRCm39) T2K probably damaging Het
Mast1 A G 8: 85,663,822 (GRCm39) probably null Het
Med12l T C 3: 59,140,633 (GRCm39) I868T probably damaging Het
Msrb1 T C 17: 24,959,147 (GRCm39) S100P probably damaging Het
Nrxn3 T A 12: 90,298,730 (GRCm39) V417E possibly damaging Het
Ntng1 T A 3: 109,842,029 (GRCm39) D248V probably damaging Het
Oaz3 T C 3: 94,342,305 (GRCm39) Q117R probably benign Het
Or2a56 A G 6: 42,932,455 (GRCm39) I8V probably benign Het
Or4f58 A G 2: 111,851,276 (GRCm39) Y308H probably benign Het
Or52e2 A G 7: 102,804,621 (GRCm39) L111P probably benign Het
Osbpl3 A C 6: 50,277,953 (GRCm39) S767A probably benign Het
Pafah1b1 A T 11: 74,576,697 (GRCm39) probably benign Het
Pard6b A G 2: 167,940,708 (GRCm39) T232A probably damaging Het
Paxip1 A T 5: 27,970,204 (GRCm39) C596S probably damaging Het
Pnpla6 T C 8: 3,573,818 (GRCm39) V422A probably benign Het
Psmd6 A T 14: 14,120,932 (GRCm38) probably benign Het
Relch T A 1: 105,647,260 (GRCm39) Y683* probably null Het
Rock2 T A 12: 17,027,741 (GRCm39) C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Sel1l T A 12: 91,780,667 (GRCm39) H658L probably damaging Het
Sh3yl1 T A 12: 30,990,313 (GRCm39) L105Q probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sirt1 T C 10: 63,171,501 (GRCm39) K227E probably benign Het
Slc25a34 A T 4: 141,350,899 (GRCm39) F37I possibly damaging Het
Slc39a5 T A 10: 128,232,918 (GRCm39) I378F probably damaging Het
Smarcad1 A T 6: 65,075,808 (GRCm39) D731V probably null Het
Sox6 T G 7: 115,140,905 (GRCm39) K483N probably damaging Het
Sp140 T A 1: 85,538,549 (GRCm39) D95E possibly damaging Het
Srgap1 G T 10: 121,628,256 (GRCm39) D882E probably benign Het
Syne4 T C 7: 30,016,258 (GRCm39) probably benign Het
Tasor2 A G 13: 3,620,391 (GRCm39) F2170S probably damaging Het
Tec T C 5: 72,926,119 (GRCm39) Y289C probably benign Het
Tmem102 A T 11: 69,695,628 (GRCm39) Y115N probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trav17 T A 14: 54,044,097 (GRCm39) M1K probably null Het
Trdn T A 10: 33,275,078 (GRCm39) probably null Het
Trp53 A T 11: 69,477,747 (GRCm39) I8F probably benign Het
Ttn T A 2: 76,585,006 (GRCm39) D22064V probably damaging Het
Ube3c G A 5: 29,837,836 (GRCm39) probably null Het
Ulk1 C T 5: 110,936,813 (GRCm39) probably null Het
Upp1 T C 11: 9,085,976 (GRCm39) V271A probably damaging Het
Vmn2r4 T C 3: 64,296,082 (GRCm39) E901G probably damaging Het
Vmn2r96 G A 17: 18,817,770 (GRCm39) G449D probably damaging Het
Vps37b T C 5: 124,144,675 (GRCm39) K165E probably damaging Het
Vwf A T 6: 125,543,268 (GRCm39) I185F possibly damaging Het
Wasf2 A G 4: 132,912,315 (GRCm39) T56A probably benign Het
Zdhhc23 C G 16: 43,793,952 (GRCm39) D241H possibly damaging Het
Zfp276 T C 8: 123,981,623 (GRCm39) S57P probably benign Het
Zxdc A G 6: 90,347,500 (GRCm39) H287R probably damaging Het
Other mutations in Nlrp4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Nlrp4c APN 7 6,069,701 (GRCm39) missense possibly damaging 0.80
IGL01458:Nlrp4c APN 7 6,103,783 (GRCm39) missense possibly damaging 0.94
IGL01464:Nlrp4c APN 7 6,103,783 (GRCm39) missense possibly damaging 0.94
IGL01470:Nlrp4c APN 7 6,103,783 (GRCm39) missense possibly damaging 0.94
IGL01481:Nlrp4c APN 7 6,103,783 (GRCm39) missense possibly damaging 0.94
IGL01531:Nlrp4c APN 7 6,063,655 (GRCm39) missense probably damaging 1.00
IGL01595:Nlrp4c APN 7 6,069,111 (GRCm39) nonsense probably null
IGL02087:Nlrp4c APN 7 6,095,582 (GRCm39) missense probably damaging 1.00
IGL02226:Nlrp4c APN 7 6,069,828 (GRCm39) missense possibly damaging 0.78
IGL02588:Nlrp4c APN 7 6,087,647 (GRCm39) missense probably benign 0.25
IGL02822:Nlrp4c APN 7 6,068,726 (GRCm39) missense probably damaging 1.00
IGL02884:Nlrp4c APN 7 6,101,951 (GRCm39) missense probably damaging 1.00
IGL02943:Nlrp4c APN 7 6,068,974 (GRCm39) missense probably damaging 0.96
IGL03017:Nlrp4c APN 7 6,087,679 (GRCm39) missense probably benign 0.23
R0347:Nlrp4c UTSW 7 6,069,415 (GRCm39) missense possibly damaging 0.69
R0579:Nlrp4c UTSW 7 6,063,844 (GRCm39) missense probably benign 0.05
R1051:Nlrp4c UTSW 7 6,068,942 (GRCm39) missense probably benign 0.01
R1596:Nlrp4c UTSW 7 6,069,777 (GRCm39) missense probably benign
R1636:Nlrp4c UTSW 7 6,069,737 (GRCm39) missense possibly damaging 0.64
R1739:Nlrp4c UTSW 7 6,076,221 (GRCm39) missense probably damaging 1.00
R1766:Nlrp4c UTSW 7 6,076,113 (GRCm39) missense probably benign 0.00
R1824:Nlrp4c UTSW 7 6,069,955 (GRCm39) splice site probably null
R1827:Nlrp4c UTSW 7 6,068,765 (GRCm39) missense probably damaging 1.00
R1858:Nlrp4c UTSW 7 6,087,655 (GRCm39) missense probably benign 0.02
R1902:Nlrp4c UTSW 7 6,068,818 (GRCm39) missense probably damaging 0.98
R2217:Nlrp4c UTSW 7 6,076,113 (GRCm39) missense probably benign
R2415:Nlrp4c UTSW 7 6,069,047 (GRCm39) missense probably damaging 1.00
R3004:Nlrp4c UTSW 7 6,068,524 (GRCm39) missense probably benign 0.28
R3005:Nlrp4c UTSW 7 6,068,524 (GRCm39) missense probably benign 0.28
R3410:Nlrp4c UTSW 7 6,095,569 (GRCm39) missense possibly damaging 0.69
R3411:Nlrp4c UTSW 7 6,095,569 (GRCm39) missense possibly damaging 0.69
R3710:Nlrp4c UTSW 7 6,068,627 (GRCm39) missense probably damaging 0.99
R4072:Nlrp4c UTSW 7 6,075,709 (GRCm39) missense probably benign 0.00
R4073:Nlrp4c UTSW 7 6,075,709 (GRCm39) missense probably benign 0.00
R4075:Nlrp4c UTSW 7 6,075,709 (GRCm39) missense probably benign 0.00
R4076:Nlrp4c UTSW 7 6,075,709 (GRCm39) missense probably benign 0.00
R4542:Nlrp4c UTSW 7 6,103,826 (GRCm39) nonsense probably null
R4709:Nlrp4c UTSW 7 6,068,424 (GRCm39) missense probably benign 0.31
R5043:Nlrp4c UTSW 7 6,069,824 (GRCm39) missense probably benign 0.01
R5258:Nlrp4c UTSW 7 6,069,622 (GRCm39) missense probably benign 0.06
R6164:Nlrp4c UTSW 7 6,095,507 (GRCm39) missense probably damaging 1.00
R6383:Nlrp4c UTSW 7 6,069,052 (GRCm39) missense probably benign
R6650:Nlrp4c UTSW 7 6,068,948 (GRCm39) missense probably damaging 0.99
R6810:Nlrp4c UTSW 7 6,069,754 (GRCm39) missense probably damaging 1.00
R7095:Nlrp4c UTSW 7 6,063,792 (GRCm39) missense probably damaging 0.97
R7102:Nlrp4c UTSW 7 6,068,708 (GRCm39) nonsense probably null
R7104:Nlrp4c UTSW 7 6,068,708 (GRCm39) nonsense probably null
R7232:Nlrp4c UTSW 7 6,068,708 (GRCm39) nonsense probably null
R7444:Nlrp4c UTSW 7 6,095,595 (GRCm39) nonsense probably null
R7705:Nlrp4c UTSW 7 6,075,635 (GRCm39) missense probably damaging 0.97
R7966:Nlrp4c UTSW 7 6,069,322 (GRCm39) missense probably damaging 0.99
R8506:Nlrp4c UTSW 7 6,103,775 (GRCm39) missense possibly damaging 0.47
R8677:Nlrp4c UTSW 7 6,075,644 (GRCm39) missense probably damaging 0.99
R8708:Nlrp4c UTSW 7 6,068,603 (GRCm39) missense probably damaging 1.00
R8838:Nlrp4c UTSW 7 6,069,337 (GRCm39) missense
R9031:Nlrp4c UTSW 7 6,107,608 (GRCm39) makesense probably null
R9193:Nlrp4c UTSW 7 6,095,621 (GRCm39) missense probably benign
R9329:Nlrp4c UTSW 7 6,068,498 (GRCm39) missense probably benign
R9388:Nlrp4c UTSW 7 6,069,874 (GRCm39) nonsense probably null
R9474:Nlrp4c UTSW 7 6,068,626 (GRCm39) missense possibly damaging 0.83
R9567:Nlrp4c UTSW 7 6,063,624 (GRCm39) missense probably benign 0.17
R9702:Nlrp4c UTSW 7 6,068,801 (GRCm39) missense probably benign 0.00
X0060:Nlrp4c UTSW 7 6,068,917 (GRCm39) missense probably damaging 1.00
Z1088:Nlrp4c UTSW 7 6,069,635 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCTACCCCAGAGACTTTTG -3'
(R):5'- TGTCAGTCCACATACCCTCAGC -3'

Sequencing Primer
(F):5'- CCCCAGAGACTTTTGAGAAAATG -3'
(R):5'- ATACCCTCAGCGGCCAGAG -3'
Posted On 2015-12-29