Incidental Mutation 'R4776:Syne4'
ID367929
Institutional Source Beutler Lab
Gene Symbol Syne4
Ensembl Gene ENSMUSG00000019737
Gene Namespectrin repeat containing, nuclear envelope family member 4
Synonyms
MMRRC Submission 042413-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4776 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30314807-30319046 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 30316833 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054594] [ENSMUST00000060834] [ENSMUST00000098585] [ENSMUST00000098586] [ENSMUST00000136887] [ENSMUST00000137550] [ENSMUST00000176504] [ENSMUST00000177078] [ENSMUST00000176789] [ENSMUST00000176304]
Predicted Effect probably benign
Transcript: ENSMUST00000054594
SMART Domains Protein: ENSMUSP00000055874
Gene: ENSMUSG00000019737

DomainStartEndE-ValueType
Blast:SPEC 96 198 2e-34 BLAST
low complexity region 222 234 N/A INTRINSIC
low complexity region 290 315 N/A INTRINSIC
KASH 335 388 2.85e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060834
SMART Domains Protein: ENSMUSP00000051515
Gene: ENSMUSG00000042831

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 23 224 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098585
SMART Domains Protein: ENSMUSP00000096184
Gene: ENSMUSG00000074210

DomainStartEndE-ValueType
low complexity region 74 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098586
SMART Domains Protein: ENSMUSP00000096185
Gene: ENSMUSG00000074211

DomainStartEndE-ValueType
Pfam:Complex1_LYR 9 63 2.1e-16 PFAM
Pfam:Complex1_LYR_1 9 65 5.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135882
Predicted Effect probably benign
Transcript: ENSMUST00000136887
SMART Domains Protein: ENSMUSP00000121953
Gene: ENSMUSG00000042831

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 3 210 2.1e-16 PFAM
Pfam:2OG-FeII_Oxy 82 213 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176006
Predicted Effect probably benign
Transcript: ENSMUST00000176504
SMART Domains Protein: ENSMUSP00000135844
Gene: ENSMUSG00000019737

DomainStartEndE-ValueType
Blast:SPEC 92 170 2e-33 BLAST
low complexity region 194 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177078
SMART Domains Protein: ENSMUSP00000135895
Gene: ENSMUSG00000019737

DomainStartEndE-ValueType
Blast:SPEC 88 150 4e-24 BLAST
low complexity region 174 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176987
Predicted Effect probably benign
Transcript: ENSMUST00000176789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177257
Predicted Effect probably benign
Transcript: ENSMUST00000176304
SMART Domains Protein: ENSMUSP00000135637
Gene: ENSMUSG00000019737

DomainStartEndE-ValueType
Blast:SPEC 96 196 3e-34 BLAST
low complexity region 197 232 N/A INTRINSIC
KASH 252 305 2.85e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176232
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nesprin family of genes, that encode KASH (Klarsicht, Anc-1, Syne Homology) domain-containing proteins. In addition to the KASH domain, this protein also contains a coiled-coil and leucine zipper region, a spectrin repeat, and a kinesin-1 binding region. This protein localizes to the outer nuclear membrane, and is part of the linker of nucleoskeleton and cytoskeleton (LINC) complex in the nuclear envelope. LINC complexes are formed by SUN (Sad1, UNC-84)-KASH pairs, and are thought to mechanically couple nuclear components to the cytoskeleton. Mutations in this gene have been associated with progressive high-frequency hearing loss. The absence of this protein in mice also caused hearing loss, and changes in hair cell morphology in the ears. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss associated with outer hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,719,535 Y683* probably null Het
2610028H24Rik A T 10: 76,457,512 M156L probably benign Het
4930470P17Rik C T 2: 170,579,724 A79T unknown Het
4930522L14Rik A G 5: 109,736,873 I373T probably benign Het
A830010M20Rik C A 5: 107,510,451 A1117E probably damaging Het
Amotl1 G A 9: 14,593,373 Q217* probably null Het
Ankrd28 A T 14: 31,732,054 C254S probably damaging Het
Ap2a1 A G 7: 44,901,546 probably benign Het
Arfgef3 A T 10: 18,654,247 S245T probably benign Het
Arntl A T 7: 113,285,037 K94I probably damaging Het
Atp1b2 A T 11: 69,601,561 D224E probably damaging Het
Boc G A 16: 44,487,721 R924W probably damaging Het
Car14 C T 3: 95,898,873 G292D probably benign Het
Cenpb T C 2: 131,178,183 probably benign Het
Ces1b A T 8: 93,063,030 D423E possibly damaging Het
Cfap54 T A 10: 92,972,694 N1373I possibly damaging Het
Chrdl2 T C 7: 100,006,541 probably benign Het
Cic T G 7: 25,282,883 S12A possibly damaging Het
Csmd2 A T 4: 128,442,892 Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 H120R possibly damaging Het
Dicer1 T A 12: 104,692,446 D1779V probably damaging Het
Dock9 G T 14: 121,610,097 H1016N possibly damaging Het
Dxo T C 17: 34,838,998 L352P probably damaging Het
Eif2b5 T A 16: 20,500,233 F78I probably damaging Het
Eri2 A G 7: 119,784,946 probably benign Het
Fam208b A G 13: 3,570,391 F2170S probably damaging Het
Fbxw7 T G 3: 84,925,689 L13V possibly damaging Het
Fgf7 T A 2: 126,035,783 C23* probably null Het
Fubp1 T A 3: 152,222,068 probably null Het
Gm2663 A T 6: 40,995,953 I240N probably damaging Het
Gnb1l C T 16: 18,548,096 Q140* probably null Het
Gnptab G A 10: 88,436,528 R1010Q probably damaging Het
Gtf2h1 G A 7: 46,822,878 W544* probably null Het
Gucy2c C T 6: 136,722,514 E586K probably damaging Het
Hc T A 2: 35,039,734 E232V probably benign Het
Ifi207 T A 1: 173,730,056 D372V unknown Het
Igkv8-28 A T 6: 70,144,118 V15E probably benign Het
Il1rap A G 16: 26,692,799 S198G possibly damaging Het
Lct A G 1: 128,300,387 I1123T probably damaging Het
Lhcgr T C 17: 88,742,697 E467G probably damaging Het
Macf1 C T 4: 123,476,015 R86K probably benign Het
Maml3 T A 3: 51,856,532 Q337L probably benign Het
March10 T A 11: 105,390,037 D474V probably benign Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mast1 A G 8: 84,937,193 probably null Het
Med12l T C 3: 59,233,212 I868T probably damaging Het
Msrb1 T C 17: 24,740,173 S100P probably damaging Het
Nlrp4c T C 7: 6,066,126 L342P probably benign Het
Nrxn3 T A 12: 90,331,956 V417E possibly damaging Het
Ntng1 T A 3: 109,934,713 D248V probably damaging Het
Oaz3 T C 3: 94,434,998 Q117R probably benign Het
Olfr1311 A G 2: 112,020,931 Y308H probably benign Het
Olfr444 A G 6: 42,955,521 I8V probably benign Het
Olfr589 A G 7: 103,155,414 L111P probably benign Het
Osbpl3 A C 6: 50,300,973 S767A probably benign Het
Pafah1b1 A T 11: 74,685,871 probably benign Het
Pard6b A G 2: 168,098,788 T232A probably damaging Het
Paxip1 A T 5: 27,765,206 C596S probably damaging Het
Pnpla6 T C 8: 3,523,818 V422A probably benign Het
Psmd6 A T 14: 14,120,932 probably benign Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sel1l T A 12: 91,813,893 H658L probably damaging Het
Sh3yl1 T A 12: 30,940,314 L105Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sirt1 T C 10: 63,335,722 K227E probably benign Het
Slc25a34 A T 4: 141,623,588 F37I possibly damaging Het
Slc39a5 T A 10: 128,397,049 I378F probably damaging Het
Smarcad1 A T 6: 65,098,824 D731V probably null Het
Sox6 T G 7: 115,541,670 K483N probably damaging Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srgap1 G T 10: 121,792,351 D882E probably benign Het
Tec T C 5: 72,768,776 Y289C probably benign Het
Tmem102 A T 11: 69,804,802 Y115N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav17 T A 14: 53,806,640 M1K probably null Het
Trdn T A 10: 33,399,082 probably null Het
Trp53 A T 11: 69,586,921 I8F probably benign Het
Ttn T A 2: 76,754,662 D22064V probably damaging Het
Ube3c G A 5: 29,632,838 probably null Het
Ulk1 C T 5: 110,788,947 probably null Het
Upp1 T C 11: 9,135,976 V271A probably damaging Het
Vmn2r4 T C 3: 64,388,661 E901G probably damaging Het
Vmn2r96 G A 17: 18,597,508 G449D probably damaging Het
Vps37b T C 5: 124,006,612 K165E probably damaging Het
Vwf A T 6: 125,566,305 I185F possibly damaging Het
Wasf2 A G 4: 133,185,004 T56A probably benign Het
Zdhhc23 C G 16: 43,973,589 D241H possibly damaging Het
Zfp276 T C 8: 123,254,884 S57P probably benign Het
Zxdc A G 6: 90,370,518 H287R probably damaging Het
Other mutations in Syne4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Syne4 APN 7 30316563 splice site probably null
IGL02386:Syne4 APN 7 30316234 missense possibly damaging 0.91
R0089:Syne4 UTSW 7 30318919 missense probably damaging 0.99
R0091:Syne4 UTSW 7 30318919 missense probably damaging 0.99
R0448:Syne4 UTSW 7 30314920 start gained probably benign
R0555:Syne4 UTSW 7 30316744 missense probably damaging 0.99
R1205:Syne4 UTSW 7 30315336 missense probably damaging 0.96
R1862:Syne4 UTSW 7 30316883 missense probably benign 0.06
R1863:Syne4 UTSW 7 30316883 missense probably benign 0.06
R5325:Syne4 UTSW 7 30318976 missense probably damaging 1.00
R6145:Syne4 UTSW 7 30316563 splice site probably null
R6479:Syne4 UTSW 7 30316915 nonsense probably null
R7823:Syne4 UTSW 7 30318855 missense probably benign 0.09
Z1088:Syne4 UTSW 7 30316336 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGTCTAGCCATGTGTTCCAGG -3'
(R):5'- CCGAGATATCTTTTGCCCTGAG -3'

Sequencing Primer
(F):5'- ATGTGTTCCAGGCCCTGCAG -3'
(R):5'- TGAGGGCCCAAGACCCC -3'
Posted On2015-12-29