Incidental Mutation 'R4776:Zfp276'
ID367940
Institutional Source Beutler Lab
Gene Symbol Zfp276
Ensembl Gene ENSMUSG00000001065
Gene Namezinc finger protein (C2H2 type) 276
SynonymsD8Ertd370e, D8Ertd377e
MMRRC Submission 042413-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R4776 (G1)
Quality Score152
Status Validated
Chromosome8
Chromosomal Location123254195-123269745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123254884 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 57 (S57P)
Ref Sequence ENSEMBL: ENSMUSP00000001092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001092] [ENSMUST00000117643] [ENSMUST00000118279] [ENSMUST00000122363] [ENSMUST00000127664] [ENSMUST00000154450] [ENSMUST00000155869]
Predicted Effect probably benign
Transcript: ENSMUST00000001092
AA Change: S57P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001092
Gene: ENSMUSG00000001065
AA Change: S57P

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.2e-13 PFAM
low complexity region 402 422 N/A INTRINSIC
ZnF_C2H2 434 458 2.24e-3 SMART
ZnF_C2H2 465 490 6.67e-2 SMART
ZnF_C2H2 496 518 1.38e-3 SMART
ZnF_C2H2 524 546 1.82e-3 SMART
ZnF_C2H2 554 577 4.79e-3 SMART
low complexity region 586 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117643
SMART Domains Protein: ENSMUSP00000113748
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 8.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118279
SMART Domains Protein: ENSMUSP00000113634
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122363
SMART Domains Protein: ENSMUSP00000113575
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 644 5.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149490
Predicted Effect unknown
Transcript: ENSMUST00000154450
AA Change: S57P
SMART Domains Protein: ENSMUSP00000119771
Gene: ENSMUSG00000001065
AA Change: S57P

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.9e-14 PFAM
low complexity region 183 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211828
Predicted Effect probably benign
Transcript: ENSMUST00000155869
SMART Domains Protein: ENSMUSP00000122184
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 223 N/A INTRINSIC
Meta Mutation Damage Score 0.0615 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,719,535 Y683* probably null Het
2610028H24Rik A T 10: 76,457,512 M156L probably benign Het
4930470P17Rik C T 2: 170,579,724 A79T unknown Het
4930522L14Rik A G 5: 109,736,873 I373T probably benign Het
A830010M20Rik C A 5: 107,510,451 A1117E probably damaging Het
Amotl1 G A 9: 14,593,373 Q217* probably null Het
Ankrd28 A T 14: 31,732,054 C254S probably damaging Het
Ap2a1 A G 7: 44,901,546 probably benign Het
Arfgef3 A T 10: 18,654,247 S245T probably benign Het
Arntl A T 7: 113,285,037 K94I probably damaging Het
Atp1b2 A T 11: 69,601,561 D224E probably damaging Het
Boc G A 16: 44,487,721 R924W probably damaging Het
Car14 C T 3: 95,898,873 G292D probably benign Het
Cenpb T C 2: 131,178,183 probably benign Het
Ces1b A T 8: 93,063,030 D423E possibly damaging Het
Cfap54 T A 10: 92,972,694 N1373I possibly damaging Het
Chrdl2 T C 7: 100,006,541 probably benign Het
Cic T G 7: 25,282,883 S12A possibly damaging Het
Csmd2 A T 4: 128,442,892 Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 H120R possibly damaging Het
Dicer1 T A 12: 104,692,446 D1779V probably damaging Het
Dock9 G T 14: 121,610,097 H1016N possibly damaging Het
Dxo T C 17: 34,838,998 L352P probably damaging Het
Eif2b5 T A 16: 20,500,233 F78I probably damaging Het
Eri2 A G 7: 119,784,946 probably benign Het
Fam208b A G 13: 3,570,391 F2170S probably damaging Het
Fbxw7 T G 3: 84,925,689 L13V possibly damaging Het
Fgf7 T A 2: 126,035,783 C23* probably null Het
Fubp1 T A 3: 152,222,068 probably null Het
Gm2663 A T 6: 40,995,953 I240N probably damaging Het
Gnb1l C T 16: 18,548,096 Q140* probably null Het
Gnptab G A 10: 88,436,528 R1010Q probably damaging Het
Gtf2h1 G A 7: 46,822,878 W544* probably null Het
Gucy2c C T 6: 136,722,514 E586K probably damaging Het
Hc T A 2: 35,039,734 E232V probably benign Het
Ifi207 T A 1: 173,730,056 D372V unknown Het
Igkv8-28 A T 6: 70,144,118 V15E probably benign Het
Il1rap A G 16: 26,692,799 S198G possibly damaging Het
Lct A G 1: 128,300,387 I1123T probably damaging Het
Lhcgr T C 17: 88,742,697 E467G probably damaging Het
Macf1 C T 4: 123,476,015 R86K probably benign Het
Maml3 T A 3: 51,856,532 Q337L probably benign Het
March10 T A 11: 105,390,037 D474V probably benign Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mast1 A G 8: 84,937,193 probably null Het
Med12l T C 3: 59,233,212 I868T probably damaging Het
Msrb1 T C 17: 24,740,173 S100P probably damaging Het
Nlrp4c T C 7: 6,066,126 L342P probably benign Het
Nrxn3 T A 12: 90,331,956 V417E possibly damaging Het
Ntng1 T A 3: 109,934,713 D248V probably damaging Het
Oaz3 T C 3: 94,434,998 Q117R probably benign Het
Olfr1311 A G 2: 112,020,931 Y308H probably benign Het
Olfr444 A G 6: 42,955,521 I8V probably benign Het
Olfr589 A G 7: 103,155,414 L111P probably benign Het
Osbpl3 A C 6: 50,300,973 S767A probably benign Het
Pafah1b1 A T 11: 74,685,871 probably benign Het
Pard6b A G 2: 168,098,788 T232A probably damaging Het
Paxip1 A T 5: 27,765,206 C596S probably damaging Het
Pnpla6 T C 8: 3,523,818 V422A probably benign Het
Psmd6 A T 14: 14,120,932 probably benign Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sel1l T A 12: 91,813,893 H658L probably damaging Het
Sh3yl1 T A 12: 30,940,314 L105Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sirt1 T C 10: 63,335,722 K227E probably benign Het
Slc25a34 A T 4: 141,623,588 F37I possibly damaging Het
Slc39a5 T A 10: 128,397,049 I378F probably damaging Het
Smarcad1 A T 6: 65,098,824 D731V probably null Het
Sox6 T G 7: 115,541,670 K483N probably damaging Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srgap1 G T 10: 121,792,351 D882E probably benign Het
Syne4 T C 7: 30,316,833 probably benign Het
Tec T C 5: 72,768,776 Y289C probably benign Het
Tmem102 A T 11: 69,804,802 Y115N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav17 T A 14: 53,806,640 M1K probably null Het
Trdn T A 10: 33,399,082 probably null Het
Trp53 A T 11: 69,586,921 I8F probably benign Het
Ttn T A 2: 76,754,662 D22064V probably damaging Het
Ube3c G A 5: 29,632,838 probably null Het
Ulk1 C T 5: 110,788,947 probably null Het
Upp1 T C 11: 9,135,976 V271A probably damaging Het
Vmn2r4 T C 3: 64,388,661 E901G probably damaging Het
Vmn2r96 G A 17: 18,597,508 G449D probably damaging Het
Vps37b T C 5: 124,006,612 K165E probably damaging Het
Vwf A T 6: 125,566,305 I185F possibly damaging Het
Wasf2 A G 4: 133,185,004 T56A probably benign Het
Zdhhc23 C G 16: 43,973,589 D241H possibly damaging Het
Zxdc A G 6: 90,370,518 H287R probably damaging Het
Other mutations in Zfp276
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Zfp276 APN 8 123258337 missense probably benign 0.01
IGL02573:Zfp276 APN 8 123264997 missense probably damaging 1.00
IGL02729:Zfp276 APN 8 123267816 missense probably damaging 1.00
IGL02956:Zfp276 APN 8 123254744 missense probably damaging 1.00
IGL03019:Zfp276 APN 8 123267934 missense probably damaging 1.00
R0087:Zfp276 UTSW 8 123265047 missense probably damaging 1.00
R0386:Zfp276 UTSW 8 123259503 nonsense probably null
R1084:Zfp276 UTSW 8 123254723 missense probably damaging 0.99
R4199:Zfp276 UTSW 8 123267825 missense probably damaging 1.00
R4506:Zfp276 UTSW 8 123264927 critical splice donor site probably null
R4584:Zfp276 UTSW 8 123268406 utr 3 prime probably benign
R4985:Zfp276 UTSW 8 123267907 missense probably damaging 1.00
R5017:Zfp276 UTSW 8 123264977 unclassified probably benign
R5018:Zfp276 UTSW 8 123264977 unclassified probably benign
R5115:Zfp276 UTSW 8 123264977 unclassified probably benign
R5116:Zfp276 UTSW 8 123264977 unclassified probably benign
R5412:Zfp276 UTSW 8 123255781 missense probably damaging 1.00
R5436:Zfp276 UTSW 8 123265282 unclassified probably benign
R5822:Zfp276 UTSW 8 123255718 missense probably benign
R6059:Zfp276 UTSW 8 123267823 missense probably damaging 1.00
R6186:Zfp276 UTSW 8 123255933 nonsense probably null
R6947:Zfp276 UTSW 8 123254904 missense probably benign
R6975:Zfp276 UTSW 8 123256831 nonsense probably null
R7313:Zfp276 UTSW 8 123267823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTAAGTCCGCTCTAGCAAG -3'
(R):5'- ATAGCAGCGACACAGAGCTG -3'

Sequencing Primer
(F):5'- GTTAAGTCCGCTCTAGCAAGAAGTC -3'
(R):5'- CAGAGCTGTCTGGGCGG -3'
Posted On2015-12-29