Incidental Mutation 'R4776:Amotl1'
ID367941
Institutional Source Beutler Lab
Gene Symbol Amotl1
Ensembl Gene ENSMUSG00000013076
Gene Nameangiomotin-like 1
SynonymsJEAP, 2310067L22Rik, 2310010G08Rik, 4932416D09Rik
MMRRC Submission 042413-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R4776 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location14541966-14645056 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 14593373 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 217 (Q217*)
Ref Sequence ENSEMBL: ENSMUSP00000152834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013220] [ENSMUST00000162901] [ENSMUST00000223132]
Predicted Effect probably null
Transcript: ENSMUST00000013220
AA Change: Q180*
SMART Domains Protein: ENSMUSP00000013220
Gene: ENSMUSG00000013076
AA Change: Q180*

DomainStartEndE-ValueType
low complexity region 203 224 N/A INTRINSIC
low complexity region 418 441 N/A INTRINSIC
coiled coil region 449 472 N/A INTRINSIC
Blast:PAC 491 532 1e-10 BLAST
low complexity region 562 575 N/A INTRINSIC
Pfam:Angiomotin_C 616 822 4.4e-96 PFAM
low complexity region 853 878 N/A INTRINSIC
low complexity region 881 895 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160770
SMART Domains Protein: ENSMUSP00000124281
Gene: ENSMUSG00000013076

DomainStartEndE-ValueType
low complexity region 117 138 N/A INTRINSIC
low complexity region 332 355 N/A INTRINSIC
coiled coil region 363 386 N/A INTRINSIC
Blast:PAC 405 446 1e-10 BLAST
low complexity region 476 489 N/A INTRINSIC
Pfam:Angiomotin_C 530 738 5.2e-95 PFAM
low complexity region 767 792 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162802
Predicted Effect probably benign
Transcript: ENSMUST00000162901
Predicted Effect probably benign
Transcript: ENSMUST00000162901
Predicted Effect probably null
Transcript: ENSMUST00000223132
AA Change: Q217*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein that is a component of tight junctions or TJs. TJs form an apical junctional structure and act to control paracellular permeability and maintain cell polarity. This protein is related to angiomotin, an angiostatin binding protein that regulates endothelial cell migration and capillary formation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,719,535 Y683* probably null Het
2610028H24Rik A T 10: 76,457,512 M156L probably benign Het
4930470P17Rik C T 2: 170,579,724 A79T unknown Het
4930522L14Rik A G 5: 109,736,873 I373T probably benign Het
A830010M20Rik C A 5: 107,510,451 A1117E probably damaging Het
Ankrd28 A T 14: 31,732,054 C254S probably damaging Het
Ap2a1 A G 7: 44,901,546 probably benign Het
Arfgef3 A T 10: 18,654,247 S245T probably benign Het
Arntl A T 7: 113,285,037 K94I probably damaging Het
Atp1b2 A T 11: 69,601,561 D224E probably damaging Het
Boc G A 16: 44,487,721 R924W probably damaging Het
Car14 C T 3: 95,898,873 G292D probably benign Het
Cenpb T C 2: 131,178,183 probably benign Het
Ces1b A T 8: 93,063,030 D423E possibly damaging Het
Cfap54 T A 10: 92,972,694 N1373I possibly damaging Het
Chrdl2 T C 7: 100,006,541 probably benign Het
Cic T G 7: 25,282,883 S12A possibly damaging Het
Csmd2 A T 4: 128,442,892 Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 H120R possibly damaging Het
Dicer1 T A 12: 104,692,446 D1779V probably damaging Het
Dock9 G T 14: 121,610,097 H1016N possibly damaging Het
Dxo T C 17: 34,838,998 L352P probably damaging Het
Eif2b5 T A 16: 20,500,233 F78I probably damaging Het
Eri2 A G 7: 119,784,946 probably benign Het
Fam208b A G 13: 3,570,391 F2170S probably damaging Het
Fbxw7 T G 3: 84,925,689 L13V possibly damaging Het
Fgf7 T A 2: 126,035,783 C23* probably null Het
Fubp1 T A 3: 152,222,068 probably null Het
Gm2663 A T 6: 40,995,953 I240N probably damaging Het
Gnb1l C T 16: 18,548,096 Q140* probably null Het
Gnptab G A 10: 88,436,528 R1010Q probably damaging Het
Gtf2h1 G A 7: 46,822,878 W544* probably null Het
Gucy2c C T 6: 136,722,514 E586K probably damaging Het
Hc T A 2: 35,039,734 E232V probably benign Het
Ifi207 T A 1: 173,730,056 D372V unknown Het
Igkv8-28 A T 6: 70,144,118 V15E probably benign Het
Il1rap A G 16: 26,692,799 S198G possibly damaging Het
Lct A G 1: 128,300,387 I1123T probably damaging Het
Lhcgr T C 17: 88,742,697 E467G probably damaging Het
Macf1 C T 4: 123,476,015 R86K probably benign Het
Maml3 T A 3: 51,856,532 Q337L probably benign Het
March10 T A 11: 105,390,037 D474V probably benign Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mast1 A G 8: 84,937,193 probably null Het
Med12l T C 3: 59,233,212 I868T probably damaging Het
Msrb1 T C 17: 24,740,173 S100P probably damaging Het
Nlrp4c T C 7: 6,066,126 L342P probably benign Het
Nrxn3 T A 12: 90,331,956 V417E possibly damaging Het
Ntng1 T A 3: 109,934,713 D248V probably damaging Het
Oaz3 T C 3: 94,434,998 Q117R probably benign Het
Olfr1311 A G 2: 112,020,931 Y308H probably benign Het
Olfr444 A G 6: 42,955,521 I8V probably benign Het
Olfr589 A G 7: 103,155,414 L111P probably benign Het
Osbpl3 A C 6: 50,300,973 S767A probably benign Het
Pafah1b1 A T 11: 74,685,871 probably benign Het
Pard6b A G 2: 168,098,788 T232A probably damaging Het
Paxip1 A T 5: 27,765,206 C596S probably damaging Het
Pnpla6 T C 8: 3,523,818 V422A probably benign Het
Psmd6 A T 14: 14,120,932 probably benign Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sel1l T A 12: 91,813,893 H658L probably damaging Het
Sh3yl1 T A 12: 30,940,314 L105Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sirt1 T C 10: 63,335,722 K227E probably benign Het
Slc25a34 A T 4: 141,623,588 F37I possibly damaging Het
Slc39a5 T A 10: 128,397,049 I378F probably damaging Het
Smarcad1 A T 6: 65,098,824 D731V probably null Het
Sox6 T G 7: 115,541,670 K483N probably damaging Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srgap1 G T 10: 121,792,351 D882E probably benign Het
Syne4 T C 7: 30,316,833 probably benign Het
Tec T C 5: 72,768,776 Y289C probably benign Het
Tmem102 A T 11: 69,804,802 Y115N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav17 T A 14: 53,806,640 M1K probably null Het
Trdn T A 10: 33,399,082 probably null Het
Trp53 A T 11: 69,586,921 I8F probably benign Het
Ttn T A 2: 76,754,662 D22064V probably damaging Het
Ube3c G A 5: 29,632,838 probably null Het
Ulk1 C T 5: 110,788,947 probably null Het
Upp1 T C 11: 9,135,976 V271A probably damaging Het
Vmn2r4 T C 3: 64,388,661 E901G probably damaging Het
Vmn2r96 G A 17: 18,597,508 G449D probably damaging Het
Vps37b T C 5: 124,006,612 K165E probably damaging Het
Vwf A T 6: 125,566,305 I185F possibly damaging Het
Wasf2 A G 4: 133,185,004 T56A probably benign Het
Zdhhc23 C G 16: 43,973,589 D241H possibly damaging Het
Zfp276 T C 8: 123,254,884 S57P probably benign Het
Zxdc A G 6: 90,370,518 H287R probably damaging Het
Other mutations in Amotl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Amotl1 APN 9 14571715 splice site probably benign
IGL02750:Amotl1 APN 9 14548791 missense probably benign 0.34
R0071:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0071:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0094:Amotl1 UTSW 9 14575387 missense probably benign 0.12
R0094:Amotl1 UTSW 9 14575387 missense probably benign 0.12
R0178:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0179:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0853:Amotl1 UTSW 9 14592778 missense probably damaging 0.99
R0941:Amotl1 UTSW 9 14596558 missense possibly damaging 0.90
R1447:Amotl1 UTSW 9 14555742 missense probably benign
R1689:Amotl1 UTSW 9 14593222 missense probably damaging 0.99
R1692:Amotl1 UTSW 9 14551722 missense possibly damaging 0.94
R1858:Amotl1 UTSW 9 14575401 missense probably benign 0.34
R2158:Amotl1 UTSW 9 14575169 missense probably benign 0.00
R2184:Amotl1 UTSW 9 14575390 missense probably benign 0.00
R3040:Amotl1 UTSW 9 14572773 missense probably benign 0.42
R4226:Amotl1 UTSW 9 14593678 missense probably benign 0.00
R4854:Amotl1 UTSW 9 14593451 nonsense probably null
R5283:Amotl1 UTSW 9 14558484 missense probably damaging 1.00
R5478:Amotl1 UTSW 9 14592752 critical splice donor site probably null
R5562:Amotl1 UTSW 9 14575297 missense possibly damaging 0.56
R5970:Amotl1 UTSW 9 14596528 missense probably damaging 1.00
R6265:Amotl1 UTSW 9 14571655 missense possibly damaging 0.93
R6974:Amotl1 UTSW 9 14644920 nonsense probably null
R7016:Amotl1 UTSW 9 14593699 missense probably damaging 0.99
R7058:Amotl1 UTSW 9 14575236 missense possibly damaging 0.94
R7317:Amotl1 UTSW 9 14575219 missense probably benign 0.02
R7730:Amotl1 UTSW 9 14555763 missense possibly damaging 0.53
R7994:Amotl1 UTSW 9 14593361 missense probably damaging 0.98
R7996:Amotl1 UTSW 9 14593705 missense possibly damaging 0.94
R8077:Amotl1 UTSW 9 14550502 missense probably damaging 1.00
R8116:Amotl1 UTSW 9 14555572 critical splice donor site probably null
R8140:Amotl1 UTSW 9 14572715 splice site probably null
R8362:Amotl1 UTSW 9 14644922 missense probably benign 0.26
R8364:Amotl1 UTSW 9 14644922 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ACCTCCGGCCATGTAATAAG -3'
(R):5'- TGATCCAGGAACAACTGCG -3'

Sequencing Primer
(F):5'- CCGGCCATGTAATAAGTGTGGC -3'
(R):5'- ATGAACCTGCTGGCCATTCAG -3'
Posted On2015-12-29