Incidental Mutation 'R4776:Arfgef3'
ID 367943
Institutional Source Beutler Lab
Gene Symbol Arfgef3
Ensembl Gene ENSMUSG00000019852
Gene Name ARFGEF family member 3
Synonyms B930094H20Rik, BIG3, D10Bwg1379e
MMRRC Submission 042413-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R4776 (G1)
Quality Score 224
Status Validated
Chromosome 10
Chromosomal Location 18463759-18619506 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18529995 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 245 (S245T)
Ref Sequence ENSEMBL: ENSMUSP00000149210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]
AlphaFold Q3UGY8
Predicted Effect probably benign
Transcript: ENSMUST00000019999
AA Change: S245T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: S245T

DomainStartEndE-ValueType
Pfam:DCB 1 170 7.1e-15 PFAM
low complexity region 236 245 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
Sec7 582 794 6e-54 SMART
Blast:Sec7 798 873 3e-20 BLAST
low complexity region 927 940 N/A INTRINSIC
Pfam:DUF1981 1237 1312 1.9e-14 PFAM
low complexity region 1641 1652 N/A INTRINSIC
low complexity region 1710 1723 N/A INTRINSIC
low complexity region 1838 1856 N/A INTRINSIC
low complexity region 2088 2099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215836
AA Change: S245T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,293,346 (GRCm39) M156L probably benign Het
4930470P17Rik C T 2: 170,421,644 (GRCm39) A79T unknown Het
4930522L14Rik A G 5: 109,884,739 (GRCm39) I373T probably benign Het
Amotl1 G A 9: 14,504,669 (GRCm39) Q217* probably null Het
Ankrd28 A T 14: 31,454,011 (GRCm39) C254S probably damaging Het
Ap2a1 A G 7: 44,550,970 (GRCm39) probably benign Het
Atp1b2 A T 11: 69,492,387 (GRCm39) D224E probably damaging Het
Bmal1 A T 7: 112,884,244 (GRCm39) K94I probably damaging Het
Boc G A 16: 44,308,084 (GRCm39) R924W probably damaging Het
Btbd8 C A 5: 107,658,317 (GRCm39) A1117E probably damaging Het
Car14 C T 3: 95,806,185 (GRCm39) G292D probably benign Het
Cenpb T C 2: 131,020,103 (GRCm39) probably benign Het
Ces1b A T 8: 93,789,658 (GRCm39) D423E possibly damaging Het
Cfap54 T A 10: 92,808,556 (GRCm39) N1373I possibly damaging Het
Chrdl2 T C 7: 99,655,748 (GRCm39) probably benign Het
Cic T G 7: 24,982,308 (GRCm39) S12A possibly damaging Het
Csmd2 A T 4: 128,336,685 (GRCm39) Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 (GRCm39) H120R possibly damaging Het
Dicer1 T A 12: 104,658,705 (GRCm39) D1779V probably damaging Het
Dock9 G T 14: 121,847,509 (GRCm39) H1016N possibly damaging Het
Dxo T C 17: 35,057,974 (GRCm39) L352P probably damaging Het
Eif2b5 T A 16: 20,318,983 (GRCm39) F78I probably damaging Het
Eri2 A G 7: 119,384,169 (GRCm39) probably benign Het
Fbxw7 T G 3: 84,832,996 (GRCm39) L13V possibly damaging Het
Fgf7 T A 2: 125,877,703 (GRCm39) C23* probably null Het
Fubp1 T A 3: 151,927,705 (GRCm39) probably null Het
Gm2663 A T 6: 40,972,887 (GRCm39) I240N probably damaging Het
Gnb1l C T 16: 18,366,846 (GRCm39) Q140* probably null Het
Gnptab G A 10: 88,272,390 (GRCm39) R1010Q probably damaging Het
Gtf2h1 G A 7: 46,472,302 (GRCm39) W544* probably null Het
Gucy2c C T 6: 136,699,512 (GRCm39) E586K probably damaging Het
Hc T A 2: 34,929,746 (GRCm39) E232V probably benign Het
Ifi207 T A 1: 173,557,622 (GRCm39) D372V unknown Het
Igkv8-28 A T 6: 70,121,102 (GRCm39) V15E probably benign Het
Il1rap A G 16: 26,511,549 (GRCm39) S198G possibly damaging Het
Lct A G 1: 128,228,124 (GRCm39) I1123T probably damaging Het
Lhcgr T C 17: 89,050,125 (GRCm39) E467G probably damaging Het
Macf1 C T 4: 123,369,808 (GRCm39) R86K probably benign Het
Maml3 T A 3: 51,763,953 (GRCm39) Q337L probably benign Het
Marchf10 T A 11: 105,280,863 (GRCm39) D474V probably benign Het
Marchf2 G T 17: 33,928,890 (GRCm39) T2K probably damaging Het
Mast1 A G 8: 85,663,822 (GRCm39) probably null Het
Med12l T C 3: 59,140,633 (GRCm39) I868T probably damaging Het
Msrb1 T C 17: 24,959,147 (GRCm39) S100P probably damaging Het
Nlrp4c T C 7: 6,069,125 (GRCm39) L342P probably benign Het
Nrxn3 T A 12: 90,298,730 (GRCm39) V417E possibly damaging Het
Ntng1 T A 3: 109,842,029 (GRCm39) D248V probably damaging Het
Oaz3 T C 3: 94,342,305 (GRCm39) Q117R probably benign Het
Or2a56 A G 6: 42,932,455 (GRCm39) I8V probably benign Het
Or4f58 A G 2: 111,851,276 (GRCm39) Y308H probably benign Het
Or52e2 A G 7: 102,804,621 (GRCm39) L111P probably benign Het
Osbpl3 A C 6: 50,277,953 (GRCm39) S767A probably benign Het
Pafah1b1 A T 11: 74,576,697 (GRCm39) probably benign Het
Pard6b A G 2: 167,940,708 (GRCm39) T232A probably damaging Het
Paxip1 A T 5: 27,970,204 (GRCm39) C596S probably damaging Het
Pnpla6 T C 8: 3,573,818 (GRCm39) V422A probably benign Het
Psmd6 A T 14: 14,120,932 (GRCm38) probably benign Het
Relch T A 1: 105,647,260 (GRCm39) Y683* probably null Het
Rock2 T A 12: 17,027,741 (GRCm39) C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Sel1l T A 12: 91,780,667 (GRCm39) H658L probably damaging Het
Sh3yl1 T A 12: 30,990,313 (GRCm39) L105Q probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sirt1 T C 10: 63,171,501 (GRCm39) K227E probably benign Het
Slc25a34 A T 4: 141,350,899 (GRCm39) F37I possibly damaging Het
Slc39a5 T A 10: 128,232,918 (GRCm39) I378F probably damaging Het
Smarcad1 A T 6: 65,075,808 (GRCm39) D731V probably null Het
Sox6 T G 7: 115,140,905 (GRCm39) K483N probably damaging Het
Sp140 T A 1: 85,538,549 (GRCm39) D95E possibly damaging Het
Srgap1 G T 10: 121,628,256 (GRCm39) D882E probably benign Het
Syne4 T C 7: 30,016,258 (GRCm39) probably benign Het
Tasor2 A G 13: 3,620,391 (GRCm39) F2170S probably damaging Het
Tec T C 5: 72,926,119 (GRCm39) Y289C probably benign Het
Tmem102 A T 11: 69,695,628 (GRCm39) Y115N probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trav17 T A 14: 54,044,097 (GRCm39) M1K probably null Het
Trdn T A 10: 33,275,078 (GRCm39) probably null Het
Trp53 A T 11: 69,477,747 (GRCm39) I8F probably benign Het
Ttn T A 2: 76,585,006 (GRCm39) D22064V probably damaging Het
Ube3c G A 5: 29,837,836 (GRCm39) probably null Het
Ulk1 C T 5: 110,936,813 (GRCm39) probably null Het
Upp1 T C 11: 9,085,976 (GRCm39) V271A probably damaging Het
Vmn2r4 T C 3: 64,296,082 (GRCm39) E901G probably damaging Het
Vmn2r96 G A 17: 18,817,770 (GRCm39) G449D probably damaging Het
Vps37b T C 5: 124,144,675 (GRCm39) K165E probably damaging Het
Vwf A T 6: 125,543,268 (GRCm39) I185F possibly damaging Het
Wasf2 A G 4: 132,912,315 (GRCm39) T56A probably benign Het
Zdhhc23 C G 16: 43,793,952 (GRCm39) D241H possibly damaging Het
Zfp276 T C 8: 123,981,623 (GRCm39) S57P probably benign Het
Zxdc A G 6: 90,347,500 (GRCm39) H287R probably damaging Het
Other mutations in Arfgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Arfgef3 APN 10 18,536,352 (GRCm39) missense probably benign 0.03
IGL00835:Arfgef3 APN 10 18,537,106 (GRCm39) missense probably benign
IGL00961:Arfgef3 APN 10 18,486,985 (GRCm39) missense probably damaging 1.00
IGL01400:Arfgef3 APN 10 18,528,454 (GRCm39) missense probably damaging 1.00
IGL01501:Arfgef3 APN 10 18,476,308 (GRCm39) missense possibly damaging 0.93
IGL01595:Arfgef3 APN 10 18,470,660 (GRCm39) missense possibly damaging 0.93
IGL01695:Arfgef3 APN 10 18,479,167 (GRCm39) missense probably benign 0.00
IGL01774:Arfgef3 APN 10 18,619,363 (GRCm39) missense possibly damaging 0.94
IGL02348:Arfgef3 APN 10 18,467,095 (GRCm39) missense probably benign 0.04
IGL02371:Arfgef3 APN 10 18,522,287 (GRCm39) missense probably benign
IGL02400:Arfgef3 APN 10 18,522,005 (GRCm39) missense probably damaging 1.00
IGL02630:Arfgef3 APN 10 18,537,140 (GRCm39) splice site probably benign
IGL02815:Arfgef3 APN 10 18,528,299 (GRCm39) missense probably damaging 1.00
IGL03178:Arfgef3 APN 10 18,488,973 (GRCm39) missense probably damaging 1.00
IGL03182:Arfgef3 APN 10 18,476,292 (GRCm39) missense probably damaging 1.00
IGL03267:Arfgef3 APN 10 18,467,630 (GRCm39) missense probably damaging 1.00
IGL03294:Arfgef3 APN 10 18,540,660 (GRCm39) missense probably damaging 0.97
IGL03410:Arfgef3 APN 10 18,476,238 (GRCm39) missense probably damaging 1.00
Bow-wow UTSW 10 18,522,478 (GRCm39) nonsense probably null
R0098:Arfgef3 UTSW 10 18,465,390 (GRCm39) missense probably damaging 1.00
R0098:Arfgef3 UTSW 10 18,465,390 (GRCm39) missense probably damaging 1.00
R0141:Arfgef3 UTSW 10 18,473,155 (GRCm39) missense probably damaging 1.00
R0164:Arfgef3 UTSW 10 18,523,663 (GRCm39) missense possibly damaging 0.77
R0164:Arfgef3 UTSW 10 18,523,663 (GRCm39) missense possibly damaging 0.77
R0241:Arfgef3 UTSW 10 18,474,962 (GRCm39) missense probably damaging 1.00
R0334:Arfgef3 UTSW 10 18,468,029 (GRCm39) missense probably damaging 0.98
R0352:Arfgef3 UTSW 10 18,537,135 (GRCm39) missense probably benign 0.17
R0415:Arfgef3 UTSW 10 18,488,875 (GRCm39) splice site probably benign
R0417:Arfgef3 UTSW 10 18,479,259 (GRCm39) missense probably damaging 1.00
R0442:Arfgef3 UTSW 10 18,553,563 (GRCm39) splice site probably benign
R0507:Arfgef3 UTSW 10 18,467,369 (GRCm39) missense probably damaging 1.00
R0573:Arfgef3 UTSW 10 18,475,036 (GRCm39) missense probably damaging 1.00
R0582:Arfgef3 UTSW 10 18,487,038 (GRCm39) missense probably damaging 1.00
R0609:Arfgef3 UTSW 10 18,473,179 (GRCm39) missense probably benign 0.31
R0826:Arfgef3 UTSW 10 18,465,414 (GRCm39) missense probably damaging 0.98
R0919:Arfgef3 UTSW 10 18,465,483 (GRCm39) missense possibly damaging 0.89
R0980:Arfgef3 UTSW 10 18,467,866 (GRCm39) missense possibly damaging 0.82
R1027:Arfgef3 UTSW 10 18,467,123 (GRCm39) missense probably benign 0.02
R1140:Arfgef3 UTSW 10 18,473,096 (GRCm39) missense possibly damaging 0.77
R1491:Arfgef3 UTSW 10 18,522,302 (GRCm39) missense probably damaging 1.00
R1493:Arfgef3 UTSW 10 18,506,627 (GRCm39) missense probably damaging 0.96
R1529:Arfgef3 UTSW 10 18,488,970 (GRCm39) nonsense probably null
R1564:Arfgef3 UTSW 10 18,467,452 (GRCm39) missense probably damaging 1.00
R1654:Arfgef3 UTSW 10 18,500,896 (GRCm39) missense probably null 0.15
R1868:Arfgef3 UTSW 10 18,537,135 (GRCm39) missense probably benign 0.17
R1876:Arfgef3 UTSW 10 18,473,104 (GRCm39) missense probably damaging 1.00
R1908:Arfgef3 UTSW 10 18,528,511 (GRCm39) missense possibly damaging 0.80
R2211:Arfgef3 UTSW 10 18,467,993 (GRCm39) missense possibly damaging 0.54
R2316:Arfgef3 UTSW 10 18,492,701 (GRCm39) missense probably benign 0.19
R2393:Arfgef3 UTSW 10 18,473,535 (GRCm39) missense possibly damaging 0.88
R2407:Arfgef3 UTSW 10 18,553,614 (GRCm39) missense possibly damaging 0.63
R3076:Arfgef3 UTSW 10 18,479,278 (GRCm39) missense probably damaging 0.99
R3077:Arfgef3 UTSW 10 18,479,278 (GRCm39) missense probably damaging 0.99
R3963:Arfgef3 UTSW 10 18,468,025 (GRCm39) missense probably damaging 1.00
R4201:Arfgef3 UTSW 10 18,495,530 (GRCm39) missense probably benign 0.01
R4241:Arfgef3 UTSW 10 18,500,912 (GRCm39) missense probably damaging 1.00
R4244:Arfgef3 UTSW 10 18,506,168 (GRCm39) missense probably damaging 1.00
R4395:Arfgef3 UTSW 10 18,473,457 (GRCm39) missense probably damaging 1.00
R4455:Arfgef3 UTSW 10 18,483,423 (GRCm39) missense probably benign 0.18
R4480:Arfgef3 UTSW 10 18,476,348 (GRCm39) missense probably damaging 1.00
R4499:Arfgef3 UTSW 10 18,484,091 (GRCm39) missense possibly damaging 0.95
R4589:Arfgef3 UTSW 10 18,521,947 (GRCm39) missense probably damaging 1.00
R4635:Arfgef3 UTSW 10 18,510,603 (GRCm39) missense probably damaging 1.00
R4801:Arfgef3 UTSW 10 18,467,654 (GRCm39) missense probably benign 0.00
R4802:Arfgef3 UTSW 10 18,467,654 (GRCm39) missense probably benign 0.00
R4807:Arfgef3 UTSW 10 18,522,385 (GRCm39) missense probably benign
R4828:Arfgef3 UTSW 10 18,528,441 (GRCm39) missense probably damaging 0.99
R4861:Arfgef3 UTSW 10 18,483,479 (GRCm39) missense probably benign 0.01
R4861:Arfgef3 UTSW 10 18,483,479 (GRCm39) missense probably benign 0.01
R4917:Arfgef3 UTSW 10 18,492,638 (GRCm39) missense probably damaging 0.99
R4918:Arfgef3 UTSW 10 18,492,638 (GRCm39) missense probably damaging 0.99
R4922:Arfgef3 UTSW 10 18,467,934 (GRCm39) missense probably damaging 0.97
R4929:Arfgef3 UTSW 10 18,506,599 (GRCm39) missense probably benign 0.00
R4937:Arfgef3 UTSW 10 18,465,454 (GRCm39) missense probably damaging 0.98
R5290:Arfgef3 UTSW 10 18,476,208 (GRCm39) missense probably damaging 1.00
R5410:Arfgef3 UTSW 10 18,486,985 (GRCm39) missense probably damaging 0.99
R5807:Arfgef3 UTSW 10 18,523,546 (GRCm39) splice site probably null
R5832:Arfgef3 UTSW 10 18,506,168 (GRCm39) missense probably damaging 1.00
R5887:Arfgef3 UTSW 10 18,483,413 (GRCm39) nonsense probably null
R6272:Arfgef3 UTSW 10 18,522,711 (GRCm39) missense probably benign 0.00
R6302:Arfgef3 UTSW 10 18,528,589 (GRCm39) missense probably damaging 0.97
R6397:Arfgef3 UTSW 10 18,483,413 (GRCm39) nonsense probably null
R6495:Arfgef3 UTSW 10 18,486,950 (GRCm39) critical splice donor site probably null
R6707:Arfgef3 UTSW 10 18,496,903 (GRCm39) missense probably benign 0.11
R6814:Arfgef3 UTSW 10 18,470,767 (GRCm39) missense probably damaging 1.00
R6830:Arfgef3 UTSW 10 18,540,637 (GRCm39) critical splice donor site probably null
R6870:Arfgef3 UTSW 10 18,522,478 (GRCm39) nonsense probably null
R6941:Arfgef3 UTSW 10 18,501,203 (GRCm39) missense possibly damaging 0.66
R7094:Arfgef3 UTSW 10 18,522,187 (GRCm39) missense probably damaging 1.00
R7179:Arfgef3 UTSW 10 18,475,015 (GRCm39) missense probably damaging 1.00
R7204:Arfgef3 UTSW 10 18,522,210 (GRCm39) missense probably damaging 1.00
R7247:Arfgef3 UTSW 10 18,501,139 (GRCm39) missense probably benign 0.00
R7249:Arfgef3 UTSW 10 18,506,583 (GRCm39) missense possibly damaging 0.62
R7318:Arfgef3 UTSW 10 18,506,211 (GRCm39) missense possibly damaging 0.89
R7391:Arfgef3 UTSW 10 18,522,007 (GRCm39) missense probably benign 0.05
R7527:Arfgef3 UTSW 10 18,522,377 (GRCm39) missense probably benign
R7618:Arfgef3 UTSW 10 18,522,029 (GRCm39) missense probably damaging 1.00
R7779:Arfgef3 UTSW 10 18,470,771 (GRCm39) missense probably damaging 0.99
R7851:Arfgef3 UTSW 10 18,468,034 (GRCm39) missense probably damaging 1.00
R8112:Arfgef3 UTSW 10 18,528,379 (GRCm39) missense possibly damaging 0.96
R8133:Arfgef3 UTSW 10 18,486,951 (GRCm39) critical splice donor site probably null
R8242:Arfgef3 UTSW 10 18,505,824 (GRCm39) missense probably benign 0.25
R8369:Arfgef3 UTSW 10 18,465,477 (GRCm39) missense probably benign 0.34
R8396:Arfgef3 UTSW 10 18,528,280 (GRCm39) critical splice donor site probably null
R8553:Arfgef3 UTSW 10 18,479,278 (GRCm39) missense probably damaging 0.99
R8798:Arfgef3 UTSW 10 18,522,799 (GRCm39) missense probably damaging 1.00
R8821:Arfgef3 UTSW 10 18,528,491 (GRCm39) missense possibly damaging 0.95
R8831:Arfgef3 UTSW 10 18,528,491 (GRCm39) missense possibly damaging 0.95
R8918:Arfgef3 UTSW 10 18,511,453 (GRCm39) missense probably benign 0.01
R8929:Arfgef3 UTSW 10 18,479,203 (GRCm39) missense probably damaging 1.00
R9001:Arfgef3 UTSW 10 18,522,476 (GRCm39) missense probably benign 0.32
R9077:Arfgef3 UTSW 10 18,500,899 (GRCm39) missense possibly damaging 0.81
R9258:Arfgef3 UTSW 10 18,465,387 (GRCm39) missense probably damaging 1.00
R9267:Arfgef3 UTSW 10 18,475,028 (GRCm39) missense probably damaging 1.00
R9358:Arfgef3 UTSW 10 18,492,628 (GRCm39) missense probably damaging 1.00
R9388:Arfgef3 UTSW 10 18,505,877 (GRCm39) missense probably benign 0.35
R9389:Arfgef3 UTSW 10 18,479,271 (GRCm39) missense probably damaging 1.00
R9563:Arfgef3 UTSW 10 18,522,275 (GRCm39) missense probably damaging 1.00
R9713:Arfgef3 UTSW 10 18,528,556 (GRCm39) missense probably damaging 1.00
X0026:Arfgef3 UTSW 10 18,528,374 (GRCm39) missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18,510,600 (GRCm39) missense probably benign 0.26
Z1176:Arfgef3 UTSW 10 18,484,106 (GRCm39) missense probably damaging 0.97
Z1176:Arfgef3 UTSW 10 18,467,185 (GRCm39) missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18,503,376 (GRCm39) missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18,483,524 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCTGATGTACACAAAGC -3'
(R):5'- CTGCTCAGTTGCTGGGAATTAG -3'

Sequencing Primer
(F):5'- CAAAGCAATTTTTCTACCTGGAGGGC -3'
(R):5'- TTATGCTAAAGGACAAAGCTCTACC -3'
Posted On 2015-12-29