Incidental Mutation 'R4776:Gnptab'
ID367947
Institutional Source Beutler Lab
Gene Symbol Gnptab
Ensembl Gene ENSMUSG00000035311
Gene NameN-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
SynonymsEG432486
MMRRC Submission 042413-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R4776 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location88379132-88447329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88436528 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 1010 (R1010Q)
Ref Sequence ENSEMBL: ENSMUSP00000020251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]
Predicted Effect probably damaging
Transcript: ENSMUST00000020251
AA Change: R1010Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: R1010Q

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Stealth_CR1 73 101 6.6e-14 PFAM
Pfam:Stealth_CR2 322 429 8.8e-49 PFAM
NL 431 469 3.82e-7 SMART
low complexity region 480 490 N/A INTRINSIC
NL 498 536 2.37e-2 SMART
DMAP_binding 699 813 6.14e-38 SMART
Pfam:Stealth_CR3 934 982 2.9e-21 PFAM
Pfam:Stealth_CR4 1117 1173 7.9e-28 PFAM
transmembrane domain 1192 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141343
Predicted Effect probably benign
Transcript: ENSMUST00000151273
SMART Domains Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155306
Meta Mutation Damage Score 0.1336 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,719,535 Y683* probably null Het
2610028H24Rik A T 10: 76,457,512 M156L probably benign Het
4930470P17Rik C T 2: 170,579,724 A79T unknown Het
4930522L14Rik A G 5: 109,736,873 I373T probably benign Het
A830010M20Rik C A 5: 107,510,451 A1117E probably damaging Het
Amotl1 G A 9: 14,593,373 Q217* probably null Het
Ankrd28 A T 14: 31,732,054 C254S probably damaging Het
Ap2a1 A G 7: 44,901,546 probably benign Het
Arfgef3 A T 10: 18,654,247 S245T probably benign Het
Arntl A T 7: 113,285,037 K94I probably damaging Het
Atp1b2 A T 11: 69,601,561 D224E probably damaging Het
Boc G A 16: 44,487,721 R924W probably damaging Het
Car14 C T 3: 95,898,873 G292D probably benign Het
Cenpb T C 2: 131,178,183 probably benign Het
Ces1b A T 8: 93,063,030 D423E possibly damaging Het
Cfap54 T A 10: 92,972,694 N1373I possibly damaging Het
Chrdl2 T C 7: 100,006,541 probably benign Het
Cic T G 7: 25,282,883 S12A possibly damaging Het
Csmd2 A T 4: 128,442,892 Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 H120R possibly damaging Het
Dicer1 T A 12: 104,692,446 D1779V probably damaging Het
Dock9 G T 14: 121,610,097 H1016N possibly damaging Het
Dxo T C 17: 34,838,998 L352P probably damaging Het
Eif2b5 T A 16: 20,500,233 F78I probably damaging Het
Eri2 A G 7: 119,784,946 probably benign Het
Fam208b A G 13: 3,570,391 F2170S probably damaging Het
Fbxw7 T G 3: 84,925,689 L13V possibly damaging Het
Fgf7 T A 2: 126,035,783 C23* probably null Het
Fubp1 T A 3: 152,222,068 probably null Het
Gm2663 A T 6: 40,995,953 I240N probably damaging Het
Gnb1l C T 16: 18,548,096 Q140* probably null Het
Gtf2h1 G A 7: 46,822,878 W544* probably null Het
Gucy2c C T 6: 136,722,514 E586K probably damaging Het
Hc T A 2: 35,039,734 E232V probably benign Het
Ifi207 T A 1: 173,730,056 D372V unknown Het
Igkv8-28 A T 6: 70,144,118 V15E probably benign Het
Il1rap A G 16: 26,692,799 S198G possibly damaging Het
Lct A G 1: 128,300,387 I1123T probably damaging Het
Lhcgr T C 17: 88,742,697 E467G probably damaging Het
Macf1 C T 4: 123,476,015 R86K probably benign Het
Maml3 T A 3: 51,856,532 Q337L probably benign Het
March10 T A 11: 105,390,037 D474V probably benign Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mast1 A G 8: 84,937,193 probably null Het
Med12l T C 3: 59,233,212 I868T probably damaging Het
Msrb1 T C 17: 24,740,173 S100P probably damaging Het
Nlrp4c T C 7: 6,066,126 L342P probably benign Het
Nrxn3 T A 12: 90,331,956 V417E possibly damaging Het
Ntng1 T A 3: 109,934,713 D248V probably damaging Het
Oaz3 T C 3: 94,434,998 Q117R probably benign Het
Olfr1311 A G 2: 112,020,931 Y308H probably benign Het
Olfr444 A G 6: 42,955,521 I8V probably benign Het
Olfr589 A G 7: 103,155,414 L111P probably benign Het
Osbpl3 A C 6: 50,300,973 S767A probably benign Het
Pafah1b1 A T 11: 74,685,871 probably benign Het
Pard6b A G 2: 168,098,788 T232A probably damaging Het
Paxip1 A T 5: 27,765,206 C596S probably damaging Het
Pnpla6 T C 8: 3,523,818 V422A probably benign Het
Psmd6 A T 14: 14,120,932 probably benign Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sel1l T A 12: 91,813,893 H658L probably damaging Het
Sh3yl1 T A 12: 30,940,314 L105Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sirt1 T C 10: 63,335,722 K227E probably benign Het
Slc25a34 A T 4: 141,623,588 F37I possibly damaging Het
Slc39a5 T A 10: 128,397,049 I378F probably damaging Het
Smarcad1 A T 6: 65,098,824 D731V probably null Het
Sox6 T G 7: 115,541,670 K483N probably damaging Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srgap1 G T 10: 121,792,351 D882E probably benign Het
Syne4 T C 7: 30,316,833 probably benign Het
Tec T C 5: 72,768,776 Y289C probably benign Het
Tmem102 A T 11: 69,804,802 Y115N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav17 T A 14: 53,806,640 M1K probably null Het
Trdn T A 10: 33,399,082 probably null Het
Trp53 A T 11: 69,586,921 I8F probably benign Het
Ttn T A 2: 76,754,662 D22064V probably damaging Het
Ube3c G A 5: 29,632,838 probably null Het
Ulk1 C T 5: 110,788,947 probably null Het
Upp1 T C 11: 9,135,976 V271A probably damaging Het
Vmn2r4 T C 3: 64,388,661 E901G probably damaging Het
Vmn2r96 G A 17: 18,597,508 G449D probably damaging Het
Vps37b T C 5: 124,006,612 K165E probably damaging Het
Vwf A T 6: 125,566,305 I185F possibly damaging Het
Wasf2 A G 4: 133,185,004 T56A probably benign Het
Zdhhc23 C G 16: 43,973,589 D241H possibly damaging Het
Zfp276 T C 8: 123,254,884 S57P probably benign Het
Zxdc A G 6: 90,370,518 H287R probably damaging Het
Other mutations in Gnptab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Gnptab APN 10 88433065 missense probably damaging 0.99
IGL01346:Gnptab APN 10 88436179 missense possibly damaging 0.65
IGL01626:Gnptab APN 10 88437495 missense probably damaging 0.98
IGL01642:Gnptab APN 10 88436132 missense possibly damaging 0.89
IGL02121:Gnptab APN 10 88429461 missense possibly damaging 0.90
IGL03076:Gnptab APN 10 88440289 missense possibly damaging 0.91
IGL03130:Gnptab APN 10 88436371 missense possibly damaging 0.95
maze UTSW 10 88432573 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0114:Gnptab UTSW 10 88433400 missense possibly damaging 0.48
R0206:Gnptab UTSW 10 88439510 missense probably damaging 0.98
R0288:Gnptab UTSW 10 88433105 missense probably benign 0.00
R0329:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0330:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0369:Gnptab UTSW 10 88433594 missense possibly damaging 0.87
R0385:Gnptab UTSW 10 88436525 missense probably damaging 1.00
R0522:Gnptab UTSW 10 88431466 splice site probably benign
R0569:Gnptab UTSW 10 88428557 missense possibly damaging 0.89
R0671:Gnptab UTSW 10 88443304 splice site probably benign
R0834:Gnptab UTSW 10 88429952 missense probably damaging 1.00
R1375:Gnptab UTSW 10 88432573 missense probably damaging 1.00
R1443:Gnptab UTSW 10 88434081 missense probably damaging 1.00
R1464:Gnptab UTSW 10 88445754 splice site probably benign
R1471:Gnptab UTSW 10 88445763 missense probably benign
R1570:Gnptab UTSW 10 88419454 missense probably damaging 0.99
R1612:Gnptab UTSW 10 88428482 splice site probably null
R1614:Gnptab UTSW 10 88414589 missense probably benign
R1638:Gnptab UTSW 10 88436167 missense possibly damaging 0.94
R1739:Gnptab UTSW 10 88436095 missense probably benign 0.14
R1894:Gnptab UTSW 10 88419127 missense possibly damaging 0.69
R2092:Gnptab UTSW 10 88440305 nonsense probably null
R2118:Gnptab UTSW 10 88436398 missense probably benign 0.13
R2144:Gnptab UTSW 10 88428506 missense possibly damaging 0.89
R2174:Gnptab UTSW 10 88434044 missense probably damaging 1.00
R3847:Gnptab UTSW 10 88433577 nonsense probably null
R3943:Gnptab UTSW 10 88433894 missense probably benign
R4434:Gnptab UTSW 10 88412622 missense probably damaging 1.00
R4545:Gnptab UTSW 10 88414595 missense probably benign 0.00
R4786:Gnptab UTSW 10 88436182 missense probably damaging 1.00
R4880:Gnptab UTSW 10 88432551 nonsense probably null
R4889:Gnptab UTSW 10 88433913 missense probably benign 0.00
R4923:Gnptab UTSW 10 88429623 missense probably benign 0.17
R5694:Gnptab UTSW 10 88414486 missense probably benign 0.01
R5943:Gnptab UTSW 10 88433514 missense probably benign 0.00
R6027:Gnptab UTSW 10 88433225 missense probably damaging 0.98
R6074:Gnptab UTSW 10 88433078 missense probably damaging 1.00
R6119:Gnptab UTSW 10 88431395 missense probably damaging 1.00
R6182:Gnptab UTSW 10 88429480 missense possibly damaging 0.71
R6757:Gnptab UTSW 10 88437502 missense probably damaging 0.98
R6910:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R6911:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R7094:Gnptab UTSW 10 88379504 missense possibly damaging 0.66
R7101:Gnptab UTSW 10 88440312 missense probably benign 0.19
R7164:Gnptab UTSW 10 88434070 nonsense probably null
R7214:Gnptab UTSW 10 88379157 unclassified probably benign
R7316:Gnptab UTSW 10 88400710 missense probably damaging 1.00
R7463:Gnptab UTSW 10 88431389 missense probably damaging 1.00
R7596:Gnptab UTSW 10 88443370 missense probably damaging 0.99
R7654:Gnptab UTSW 10 88445819 missense possibly damaging 0.63
R7722:Gnptab UTSW 10 88379528 missense probably damaging 0.99
X0064:Gnptab UTSW 10 88436530 missense probably damaging 1.00
X0066:Gnptab UTSW 10 88412011 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCTGAAGAATTTGACAAGACTTC -3'
(R):5'- GACTAATCCCAGTGCAGTACC -3'

Sequencing Primer
(F):5'- GACTTCATTTCACAAGGTGCG -3'
(R):5'- GTGCAGTACCACAAAACACATTG -3'
Posted On2015-12-29