Mutagenetix > Incidental Mutation

Incidental Mutation 'R4776:Cfap54'

367948

Institutional Source

Beutler Lab

Gene Symbol

Cfap54

Ensembl Gene

ENSMUSG00000020014

Gene Name

cilia and flagella associated protein 54

Synonyms

LOC380653, Gm872, 4930485B16Rik

MMRRC Submission

042413-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R4776 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92775619-93081618 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 92972694 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 1373 (N1373I)

Ref Sequence

ENSEMBL: ENSMUSP00000148636 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000170065] [ENSMUST00000212902]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168110
AA Change: N1373I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: N1373I

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	104	642	1.1e-269	PFAM
low complexity region	842	851	N/A	INTRINSIC
low complexity region	902	915	N/A	INTRINSIC
Blast:FN3	916	1002	4e-48	BLAST
low complexity region	1409	1426	N/A	INTRINSIC
low complexity region	1974	1984	N/A	INTRINSIC
low complexity region	2354	2370	N/A	INTRINSIC
low complexity region	2500	2513	N/A	INTRINSIC
low complexity region	2605	2616	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170065

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212902
AA Change: N1373I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.1928

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

98% (94/96)

MGI Phenotype

PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,719,535	Y683*	probably null	Het
2610028H24Rik	A	T	10: 76,457,512	M156L	probably benign	Het
4930470P17Rik	C	T	2: 170,579,724	A79T	unknown	Het
4930522L14Rik	A	G	5: 109,736,873	I373T	probably benign	Het
A830010M20Rik	C	A	5: 107,510,451	A1117E	probably damaging	Het
Amotl1	G	A	9: 14,593,373	Q217*	probably null	Het
Ankrd28	A	T	14: 31,732,054	C254S	probably damaging	Het
Ap2a1	A	G	7: 44,901,546		probably benign	Het
Arfgef3	A	T	10: 18,654,247	S245T	probably benign	Het
Arntl	A	T	7: 113,285,037	K94I	probably damaging	Het
Atp1b2	A	T	11: 69,601,561	D224E	probably damaging	Het
Boc	G	A	16: 44,487,721	R924W	probably damaging	Het
Car14	C	T	3: 95,898,873	G292D	probably benign	Het
Cenpb	T	C	2: 131,178,183		probably benign	Het
Ces1b	A	T	8: 93,063,030	D423E	possibly damaging	Het
Chrdl2	T	C	7: 100,006,541		probably benign	Het
Cic	T	G	7: 25,282,883	S12A	possibly damaging	Het
Csmd2	A	T	4: 128,442,892	Q1421L	probably benign	Het
D630039A03Rik	T	C	4: 57,910,452	H120R	possibly damaging	Het
Dicer1	T	A	12: 104,692,446	D1779V	probably damaging	Het
Dock9	G	T	14: 121,610,097	H1016N	possibly damaging	Het
Dxo	T	C	17: 34,838,998	L352P	probably damaging	Het
Eif2b5	T	A	16: 20,500,233	F78I	probably damaging	Het
Eri2	A	G	7: 119,784,946		probably benign	Het
Fam208b	A	G	13: 3,570,391	F2170S	probably damaging	Het
Fbxw7	T	G	3: 84,925,689	L13V	possibly damaging	Het
Fgf7	T	A	2: 126,035,783	C23*	probably null	Het
Fubp1	T	A	3: 152,222,068		probably null	Het
Gm2663	A	T	6: 40,995,953	I240N	probably damaging	Het
Gnb1l	C	T	16: 18,548,096	Q140*	probably null	Het
Gnptab	G	A	10: 88,436,528	R1010Q	probably damaging	Het
Gtf2h1	G	A	7: 46,822,878	W544*	probably null	Het
Gucy2c	C	T	6: 136,722,514	E586K	probably damaging	Het
Hc	T	A	2: 35,039,734	E232V	probably benign	Het
Ifi207	T	A	1: 173,730,056	D372V	unknown	Het
Igkv8-28	A	T	6: 70,144,118	V15E	probably benign	Het
Il1rap	A	G	16: 26,692,799	S198G	possibly damaging	Het
Lct	A	G	1: 128,300,387	I1123T	probably damaging	Het
Lhcgr	T	C	17: 88,742,697	E467G	probably damaging	Het
Macf1	C	T	4: 123,476,015	R86K	probably benign	Het
Maml3	T	A	3: 51,856,532	Q337L	probably benign	Het
March10	T	A	11: 105,390,037	D474V	probably benign	Het
March2	G	T	17: 33,709,916	T2K	probably damaging	Het
Mast1	A	G	8: 84,937,193		probably null	Het
Med12l	T	C	3: 59,233,212	I868T	probably damaging	Het
Msrb1	T	C	17: 24,740,173	S100P	probably damaging	Het
Nlrp4c	T	C	7: 6,066,126	L342P	probably benign	Het
Nrxn3	T	A	12: 90,331,956	V417E	possibly damaging	Het
Ntng1	T	A	3: 109,934,713	D248V	probably damaging	Het
Oaz3	T	C	3: 94,434,998	Q117R	probably benign	Het
Olfr1311	A	G	2: 112,020,931	Y308H	probably benign	Het
Olfr444	A	G	6: 42,955,521	I8V	probably benign	Het
Olfr589	A	G	7: 103,155,414	L111P	probably benign	Het
Osbpl3	A	C	6: 50,300,973	S767A	probably benign	Het
Pafah1b1	A	T	11: 74,685,871		probably benign	Het
Pard6b	A	G	2: 168,098,788	T232A	probably damaging	Het
Paxip1	A	T	5: 27,765,206	C596S	probably damaging	Het
Pnpla6	T	C	8: 3,523,818	V422A	probably benign	Het
Psmd6	A	T	14: 14,120,932		probably benign	Het
Rock2	T	A	12: 16,977,740	C1353S	probably damaging	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Sel1l	T	A	12: 91,813,893	H658L	probably damaging	Het
Sh3yl1	T	A	12: 30,940,314	L105Q	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sirt1	T	C	10: 63,335,722	K227E	probably benign	Het
Slc25a34	A	T	4: 141,623,588	F37I	possibly damaging	Het
Slc39a5	T	A	10: 128,397,049	I378F	probably damaging	Het
Smarcad1	A	T	6: 65,098,824	D731V	probably null	Het
Sox6	T	G	7: 115,541,670	K483N	probably damaging	Het
Sp140	T	A	1: 85,610,828	D95E	possibly damaging	Het
Srgap1	G	T	10: 121,792,351	D882E	probably benign	Het
Syne4	T	C	7: 30,316,833		probably benign	Het
Tec	T	C	5: 72,768,776	Y289C	probably benign	Het
Tmem102	A	T	11: 69,804,802	Y115N	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trav17	T	A	14: 53,806,640	M1K	probably null	Het
Trdn	T	A	10: 33,399,082		probably null	Het
Trp53	A	T	11: 69,586,921	I8F	probably benign	Het
Ttn	T	A	2: 76,754,662	D22064V	probably damaging	Het
Ube3c	G	A	5: 29,632,838		probably null	Het
Ulk1	C	T	5: 110,788,947		probably null	Het
Upp1	T	C	11: 9,135,976	V271A	probably damaging	Het
Vmn2r4	T	C	3: 64,388,661	E901G	probably damaging	Het
Vmn2r96	G	A	17: 18,597,508	G449D	probably damaging	Het
Vps37b	T	C	5: 124,006,612	K165E	probably damaging	Het
Vwf	A	T	6: 125,566,305	I185F	possibly damaging	Het
Wasf2	A	G	4: 133,185,004	T56A	probably benign	Het
Zdhhc23	C	G	16: 43,973,589	D241H	possibly damaging	Het
Zfp276	T	C	8: 123,254,884	S57P	probably benign	Het
Zxdc	A	G	6: 90,370,518	H287R	probably damaging	Het

Other mutations in Cfap54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cfap54	APN	10	93081523	missense	unknown
IGL02034:Cfap54	APN	10	93061485	missense	probably damaging	0.99
IGL02082:Cfap54	APN	10	93081458	missense	unknown
IGL02434:Cfap54	APN	10	93066754	missense	probably benign	0.20
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0040:Cfap54	UTSW	10	92977039	missense	probably benign	0.33
R0044:Cfap54	UTSW	10	93035433	missense	probably null	0.46
R0086:Cfap54	UTSW	10	93028594	missense	possibly damaging	0.86
R0104:Cfap54	UTSW	10	93028652	missense	probably damaging	1.00
R0194:Cfap54	UTSW	10	93034662	unclassified	probably benign
R0234:Cfap54	UTSW	10	92899160	nonsense	probably null
R0308:Cfap54	UTSW	10	92885364	missense	unknown
R0332:Cfap54	UTSW	10	93035457	missense	probably damaging	1.00
R0409:Cfap54	UTSW	10	92776213	missense	probably benign	0.00
R0433:Cfap54	UTSW	10	92979080	splice site	probably benign
R0436:Cfap54	UTSW	10	93038975	missense	possibly damaging	0.95
R0463:Cfap54	UTSW	10	92874943	critical splice donor site	probably null
R0523:Cfap54	UTSW	10	92908883	utr 3 prime	probably benign
R0551:Cfap54	UTSW	10	93025122	missense	probably benign	0.35
R0595:Cfap54	UTSW	10	92884736	missense	unknown
R0617:Cfap54	UTSW	10	92829650	splice site	probably benign
R0632:Cfap54	UTSW	10	92885096	missense	unknown
R0730:Cfap54	UTSW	10	93034737	missense	probably benign	0.05
R0786:Cfap54	UTSW	10	92967535	missense	possibly damaging	0.72
R0883:Cfap54	UTSW	10	92870669	missense	unknown
R1004:Cfap54	UTSW	10	93066696	splice site	probably benign
R1033:Cfap54	UTSW	10	92839449	missense	probably benign	0.07
R1168:Cfap54	UTSW	10	92937920	missense	probably damaging	0.99
R1186:Cfap54	UTSW	10	92875994	missense	unknown
R1429:Cfap54	UTSW	10	92821038	missense	probably benign	0.01
R1443:Cfap54	UTSW	10	92932721	missense	probably damaging	1.00
R1467:Cfap54	UTSW	10	92969763	missense	probably benign	0.01
R1557:Cfap54	UTSW	10	92984227	missense	possibly damaging	0.68
R1687:Cfap54	UTSW	10	92932640	missense	probably damaging	1.00
R1690:Cfap54	UTSW	10	93035442	missense	possibly damaging	0.95
R1711:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R1756:Cfap54	UTSW	10	93048061	missense	probably damaging	1.00
R1769:Cfap54	UTSW	10	92904263	critical splice donor site	probably null
R1835:Cfap54	UTSW	10	92962375	missense	probably benign	0.35
R1889:Cfap54	UTSW	10	93034710	missense	possibly damaging	0.94
R1915:Cfap54	UTSW	10	92884702	missense	unknown
R1958:Cfap54	UTSW	10	92997342	missense	probably benign	0.18
R2005:Cfap54	UTSW	10	92884768	missense	unknown
R2018:Cfap54	UTSW	10	93016604	missense	probably benign	0.00
R2045:Cfap54	UTSW	10	93038809	splice site	probably null
R2059:Cfap54	UTSW	10	92942979	unclassified	probably benign
R2100:Cfap54	UTSW	10	93001937	missense	possibly damaging	0.84
R2110:Cfap54	UTSW	10	92886367	missense	unknown
R2392:Cfap54	UTSW	10	93025011	critical splice donor site	probably null
R2508:Cfap54	UTSW	10	92997374	missense	possibly damaging	0.72
R2852:Cfap54	UTSW	10	92940155	missense	probably damaging	1.00
R2857:Cfap54	UTSW	10	93045282	missense	probably damaging	0.99
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R3107:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3108:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3157:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3158:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3159:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3161:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3508:Cfap54	UTSW	10	92885424	missense	unknown
R3730:Cfap54	UTSW	10	93011473	nonsense	probably null
R3770:Cfap54	UTSW	10	92878536	missense	unknown
R3776:Cfap54	UTSW	10	93045100	missense	probably damaging	1.00
R3778:Cfap54	UTSW	10	92904344	utr 3 prime	probably benign
R3795:Cfap54	UTSW	10	92942873	unclassified	probably benign
R3834:Cfap54	UTSW	10	92801123	splice site	probably benign
R3891:Cfap54	UTSW	10	93038846	missense	possibly damaging	0.87
R3932:Cfap54	UTSW	10	92829757	missense	probably benign	0.03
R3973:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3974:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3976:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3978:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R4190:Cfap54	UTSW	10	92885023	missense	unknown
R4389:Cfap54	UTSW	10	92967500	missense	probably benign	0.37
R4542:Cfap54	UTSW	10	93025129	missense	probably benign	0.12
R4564:Cfap54	UTSW	10	92839540	unclassified	probably benign
R4576:Cfap54	UTSW	10	93043228	critical splice donor site	probably null
R4620:Cfap54	UTSW	10	92969757	missense	probably benign	0.01
R4714:Cfap54	UTSW	10	92815918	missense	probably benign	0.01
R4762:Cfap54	UTSW	10	93061453	splice site	probably null
R4819:Cfap54	UTSW	10	92836477	nonsense	probably null
R4827:Cfap54	UTSW	10	92902075	utr 3 prime	probably benign
R4832:Cfap54	UTSW	10	92967528	missense	probably benign	0.01
R4965:Cfap54	UTSW	10	93066799	missense	probably benign	0.23
R5001:Cfap54	UTSW	10	92964534	missense	probably benign	0.01
R5060:Cfap54	UTSW	10	93039151	missense	probably damaging	1.00
R5067:Cfap54	UTSW	10	93066766	missense	probably benign	0.17
R5069:Cfap54	UTSW	10	92937774	missense	probably benign
R5094:Cfap54	UTSW	10	92898999	utr 3 prime	probably benign
R5109:Cfap54	UTSW	10	92937891	missense	probably benign	0.03
R5127:Cfap54	UTSW	10	92886387	splice site	probably null
R5143:Cfap54	UTSW	10	93029158	missense	possibly damaging	0.73
R5147:Cfap54	UTSW	10	92937838	missense	probably benign	0.00
R5158:Cfap54	UTSW	10	93065197	missense	probably damaging	1.00
R5256:Cfap54	UTSW	10	92935091	nonsense	probably null
R5256:Cfap54	UTSW	10	93045023	splice site	probably null
R5266:Cfap54	UTSW	10	92815902	missense	probably benign	0.16
R5304:Cfap54	UTSW	10	92821106	missense	probably damaging	0.97
R5369:Cfap54	UTSW	10	93061257	intron	probably benign
R5406:Cfap54	UTSW	10	93001858	missense	probably benign	0.33
R5471:Cfap54	UTSW	10	93028660	missense	probably damaging	1.00
R5485:Cfap54	UTSW	10	93029117	missense	probably damaging	1.00
R5540:Cfap54	UTSW	10	92972608	missense	possibly damaging	0.85
R5586:Cfap54	UTSW	10	92972611	nonsense	probably null
R5614:Cfap54	UTSW	10	93045049	missense	probably damaging	1.00
R5634:Cfap54	UTSW	10	92904263	critical splice donor site	probably benign
R5680:Cfap54	UTSW	10	92979017	nonsense	probably null
R5797:Cfap54	UTSW	10	92967576	missense	probably benign	0.11
R5859:Cfap54	UTSW	10	93016524	nonsense	probably null
R5878:Cfap54	UTSW	10	92964561	missense	probably benign	0.01
R5910:Cfap54	UTSW	10	93065181	missense	probably damaging	0.99
R5936:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R5994:Cfap54	UTSW	10	93039081	missense	probably damaging	0.99
R6080:Cfap54	UTSW	10	93045335	missense	possibly damaging	0.64
R6268:Cfap54	UTSW	10	93038909	missense	probably damaging	1.00
R6296:Cfap54	UTSW	10	93066846	missense	probably damaging	1.00
R6409:Cfap54	UTSW	10	92967492	missense	probably benign	0.04
R6545:Cfap54	UTSW	10	92836457	missense	probably benign	0.31
R6570:Cfap54	UTSW	10	92815958	missense	unknown
R6597:Cfap54	UTSW	10	92999040	missense	possibly damaging	0.85
R6702:Cfap54	UTSW	10	92868734	missense	unknown
R6703:Cfap54	UTSW	10	92868734	missense	unknown
R6720:Cfap54	UTSW	10	92821119	missense	probably benign	0.07
R6841:Cfap54	UTSW	10	92875015	missense	unknown
R6910:Cfap54	UTSW	10	92836512	missense	probably benign	0.29
R6953:Cfap54	UTSW	10	92994678	missense	probably benign	0.19
R7009:Cfap54	UTSW	10	92875019	missense	unknown
R7129:Cfap54	UTSW	10	93016571	missense	probably benign	0.06
R7131:Cfap54	UTSW	10	92821104	missense	probably benign	0.03
R7171:Cfap54	UTSW	10	92776210	missense	probably damaging	0.99
R7189:Cfap54	UTSW	10	92937728	missense	unknown
R7225:Cfap54	UTSW	10	92904374	missense	unknown
R7270:Cfap54	UTSW	10	92839458	missense	probably benign	0.03
R7323:Cfap54	UTSW	10	92801138	missense	probably benign	0.00
R7380:Cfap54	UTSW	10	93047978	missense	probably damaging	1.00
R7395:Cfap54	UTSW	10	92884703	missense	unknown
R7411:Cfap54	UTSW	10	92868755	missense	unknown
R7503:Cfap54	UTSW	10	92887436	splice site	probably null
R7622:Cfap54	UTSW	10	92956944	missense	unknown
R7679:Cfap54	UTSW	10	92967512	missense	probably benign	0.01
R7776:Cfap54	UTSW	10	92868741	missense	unknown
R7844:Cfap54	UTSW	10	92902058	missense	unknown
R7980:Cfap54	UTSW	10	92982060	missense	possibly damaging	0.95
R7988:Cfap54	UTSW	10	92902079	missense	unknown
R8101:Cfap54	UTSW	10	92884796	missense	unknown
R8119:Cfap54	UTSW	10	92868810	missense	unknown
R8134:Cfap54	UTSW	10	92878516	missense	unknown
R8168:Cfap54	UTSW	10	92908877	missense	unknown
R8179:Cfap54	UTSW	10	92997316	missense	possibly damaging	0.68
R8392:Cfap54	UTSW	10	92962417	missense	unknown
R8436:Cfap54	UTSW	10	92964536	missense	unknown
R8505:Cfap54	UTSW	10	92978993	missense	probably benign	0.03
R8671:Cfap54	UTSW	10	92955072	missense	unknown
R8716:Cfap54	UTSW	10	92964632	missense	probably benign	0.00
R8816:Cfap54	UTSW	10	92878592	missense	unknown
R8822:Cfap54	UTSW	10	93039141	missense	probably benign	0.09
R8827:Cfap54	UTSW	10	92938248	missense	unknown
R8920:Cfap54	UTSW	10	92940337	critical splice acceptor site	probably null
R8924:Cfap54	UTSW	10	93001823	missense	probably damaging	0.99
R8954:Cfap54	UTSW	10	93043393	missense	probably damaging	1.00
R8963:Cfap54	UTSW	10	93028700	nonsense	probably null
R9010:Cfap54	UTSW	10	92899059	missense	unknown
R9017:Cfap54	UTSW	10	92816021	missense	probably benign	0.07
R9093:Cfap54	UTSW	10	92815908	missense	probably benign	0.03
R9095:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R9142:Cfap54	UTSW	10	92984235	missense	possibly damaging	0.87
R9178:Cfap54	UTSW	10	92994717	missense	probably benign	0.10
R9196:Cfap54	UTSW	10	93037891	missense	probably benign	0.22
R9203:Cfap54	UTSW	10	93045128	missense	probably benign	0.30
R9258:Cfap54	UTSW	10	92935098	missense	unknown
R9275:Cfap54	UTSW	10	93039186	missense	possibly damaging	0.86
R9287:Cfap54	UTSW	10	92969703	missense	possibly damaging	0.50
R9289:Cfap54	UTSW	10	92821074	missense	possibly damaging	0.83
R9310:Cfap54	UTSW	10	92962315	missense	unknown
R9397:Cfap54	UTSW	10	92997285	missense	probably damaging	0.96
R9462:Cfap54	UTSW	10	92902058	missense	unknown
R9697:Cfap54	UTSW	10	92956989	missense	unknown
R9746:Cfap54	UTSW	10	92801219	missense	probably benign	0.03
R9755:Cfap54	UTSW	10	92921368	missense	unknown
X0022:Cfap54	UTSW	10	92878603	missense	unknown
X0022:Cfap54	UTSW	10	92932614	missense	probably damaging	1.00
X0027:Cfap54	UTSW	10	92878538	missense	unknown
X0027:Cfap54	UTSW	10	93001888	missense	possibly damaging	0.86
Z1177:Cfap54	UTSW	10	92979026	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCTGACTGTGAGAATATCTATGTG -3'
(R):5'- TGTCAGCTATTCTGGATGTCC -3'

Sequencing Primer
(F):5'- CTTGCCAATCTCGATCAC -3'
(R):5'- TGGATGTCCAGGGATCCC -3'

Posted On

2015-12-29