Incidental Mutation 'R4776:Trp53'
ID367952
Institutional Source Beutler Lab
Gene Symbol Trp53
Ensembl Gene ENSMUSG00000059552
Gene Nametransformation related protein 53
Synonymsp44, p53
MMRRC Submission 042413-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4776 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69580359-69591873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69586921 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 8 (I8F)
Ref Sequence ENSEMBL: ENSMUSP00000104297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005371] [ENSMUST00000108657] [ENSMUST00000108658] [ENSMUST00000171247]
Predicted Effect probably benign
Transcript: ENSMUST00000005371
AA Change: I8F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000005371
Gene: ENSMUSG00000059552
AA Change: I8F

DomainStartEndE-ValueType
Pfam:P53_TAD 5 28 1.3e-10 PFAM
low complexity region 69 86 N/A INTRINSIC
Pfam:P53 89 283 8.2e-108 PFAM
Pfam:P53_tetramer 312 353 4.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108657
AA Change: I8F

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104297
Gene: ENSMUSG00000059552
AA Change: I8F

DomainStartEndE-ValueType
Pfam:P53_TAD 5 28 6.1e-11 PFAM
low complexity region 69 86 N/A INTRINSIC
Pfam:P53 89 283 4.7e-108 PFAM
Pfam:P53_tetramer 312 353 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108658
AA Change: I11F

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104298
Gene: ENSMUSG00000059552
AA Change: I11F

DomainStartEndE-ValueType
Pfam:P53_TAD 8 31 1.4e-12 PFAM
low complexity region 72 89 N/A INTRINSIC
Pfam:P53 92 286 9.8e-113 PFAM
Pfam:P53_tetramer 316 355 5.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147512
Predicted Effect probably benign
Transcript: ENSMUST00000171247
AA Change: I11F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000127130
Gene: ENSMUSG00000059552
AA Change: I11F

DomainStartEndE-ValueType
Pfam:P53_TAD 8 31 1.2e-10 PFAM
low complexity region 72 89 N/A INTRINSIC
Pfam:P53 92 286 7.9e-108 PFAM
Pfam:P53_tetramer 315 356 4.3e-21 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: This gene encodes tumor protein p53, which responds to diverse cellular stresses to regulate target genes that induce cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. p53 protein is expressed at low level in normal cells and at a high level in a variety of transformed cell lines, where it's believed to contribute to transformation and malignancy. p53 is a DNA-binding protein containing transcription activation, DNA-binding, and oligomerization domains. It is postulated to bind to a p53-binding site and activate expression of downstream genes that inhibit growth and/or invasion, and thus function as a tumor suppressor. Mice deficient for this gene are developmentally normal but are susceptible to spontaneous tumors. Evidence to date shows that this gene contains one promoter, in contrast to alternative promoters of the human gene, and transcribes a few of splice variants which encode different isoforms, although the biological validity or the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this locus affect cell-cycle regulation and apoptosis. Null homozygotes show high, early-onset tumor incidence; some have persistent hyaloid vasculature and cataracts. Truncated or temperature-sensitive alleles cause early aging phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,719,535 Y683* probably null Het
2610028H24Rik A T 10: 76,457,512 M156L probably benign Het
4930470P17Rik C T 2: 170,579,724 A79T unknown Het
4930522L14Rik A G 5: 109,736,873 I373T probably benign Het
A830010M20Rik C A 5: 107,510,451 A1117E probably damaging Het
Amotl1 G A 9: 14,593,373 Q217* probably null Het
Ankrd28 A T 14: 31,732,054 C254S probably damaging Het
Ap2a1 A G 7: 44,901,546 probably benign Het
Arfgef3 A T 10: 18,654,247 S245T probably benign Het
Arntl A T 7: 113,285,037 K94I probably damaging Het
Atp1b2 A T 11: 69,601,561 D224E probably damaging Het
Boc G A 16: 44,487,721 R924W probably damaging Het
Car14 C T 3: 95,898,873 G292D probably benign Het
Cenpb T C 2: 131,178,183 probably benign Het
Ces1b A T 8: 93,063,030 D423E possibly damaging Het
Cfap54 T A 10: 92,972,694 N1373I possibly damaging Het
Chrdl2 T C 7: 100,006,541 probably benign Het
Cic T G 7: 25,282,883 S12A possibly damaging Het
Csmd2 A T 4: 128,442,892 Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 H120R possibly damaging Het
Dicer1 T A 12: 104,692,446 D1779V probably damaging Het
Dock9 G T 14: 121,610,097 H1016N possibly damaging Het
Dxo T C 17: 34,838,998 L352P probably damaging Het
Eif2b5 T A 16: 20,500,233 F78I probably damaging Het
Eri2 A G 7: 119,784,946 probably benign Het
Fam208b A G 13: 3,570,391 F2170S probably damaging Het
Fbxw7 T G 3: 84,925,689 L13V possibly damaging Het
Fgf7 T A 2: 126,035,783 C23* probably null Het
Fubp1 T A 3: 152,222,068 probably null Het
Gm2663 A T 6: 40,995,953 I240N probably damaging Het
Gnb1l C T 16: 18,548,096 Q140* probably null Het
Gnptab G A 10: 88,436,528 R1010Q probably damaging Het
Gtf2h1 G A 7: 46,822,878 W544* probably null Het
Gucy2c C T 6: 136,722,514 E586K probably damaging Het
Hc T A 2: 35,039,734 E232V probably benign Het
Ifi207 T A 1: 173,730,056 D372V unknown Het
Igkv8-28 A T 6: 70,144,118 V15E probably benign Het
Il1rap A G 16: 26,692,799 S198G possibly damaging Het
Lct A G 1: 128,300,387 I1123T probably damaging Het
Lhcgr T C 17: 88,742,697 E467G probably damaging Het
Macf1 C T 4: 123,476,015 R86K probably benign Het
Maml3 T A 3: 51,856,532 Q337L probably benign Het
March10 T A 11: 105,390,037 D474V probably benign Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mast1 A G 8: 84,937,193 probably null Het
Med12l T C 3: 59,233,212 I868T probably damaging Het
Msrb1 T C 17: 24,740,173 S100P probably damaging Het
Nlrp4c T C 7: 6,066,126 L342P probably benign Het
Nrxn3 T A 12: 90,331,956 V417E possibly damaging Het
Ntng1 T A 3: 109,934,713 D248V probably damaging Het
Oaz3 T C 3: 94,434,998 Q117R probably benign Het
Olfr1311 A G 2: 112,020,931 Y308H probably benign Het
Olfr444 A G 6: 42,955,521 I8V probably benign Het
Olfr589 A G 7: 103,155,414 L111P probably benign Het
Osbpl3 A C 6: 50,300,973 S767A probably benign Het
Pafah1b1 A T 11: 74,685,871 probably benign Het
Pard6b A G 2: 168,098,788 T232A probably damaging Het
Paxip1 A T 5: 27,765,206 C596S probably damaging Het
Pnpla6 T C 8: 3,523,818 V422A probably benign Het
Psmd6 A T 14: 14,120,932 probably benign Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sel1l T A 12: 91,813,893 H658L probably damaging Het
Sh3yl1 T A 12: 30,940,314 L105Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sirt1 T C 10: 63,335,722 K227E probably benign Het
Slc25a34 A T 4: 141,623,588 F37I possibly damaging Het
Slc39a5 T A 10: 128,397,049 I378F probably damaging Het
Smarcad1 A T 6: 65,098,824 D731V probably null Het
Sox6 T G 7: 115,541,670 K483N probably damaging Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srgap1 G T 10: 121,792,351 D882E probably benign Het
Syne4 T C 7: 30,316,833 probably benign Het
Tec T C 5: 72,768,776 Y289C probably benign Het
Tmem102 A T 11: 69,804,802 Y115N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav17 T A 14: 53,806,640 M1K probably null Het
Trdn T A 10: 33,399,082 probably null Het
Ttn T A 2: 76,754,662 D22064V probably damaging Het
Ube3c G A 5: 29,632,838 probably null Het
Ulk1 C T 5: 110,788,947 probably null Het
Upp1 T C 11: 9,135,976 V271A probably damaging Het
Vmn2r4 T C 3: 64,388,661 E901G probably damaging Het
Vmn2r96 G A 17: 18,597,508 G449D probably damaging Het
Vps37b T C 5: 124,006,612 K165E probably damaging Het
Vwf A T 6: 125,566,305 I185F possibly damaging Het
Wasf2 A G 4: 133,185,004 T56A probably benign Het
Zdhhc23 C G 16: 43,973,589 D241H possibly damaging Het
Zfp276 T C 8: 123,254,884 S57P probably benign Het
Zxdc A G 6: 90,370,518 H287R probably damaging Het
Other mutations in Trp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Trp53 APN 11 69588523 missense probably damaging 1.00
IGL02105:Trp53 APN 11 69588503 missense probably damaging 1.00
R0112:Trp53 UTSW 11 69588679 missense probably damaging 1.00
R0196:Trp53 UTSW 11 69588680 missense probably damaging 1.00
R0512:Trp53 UTSW 11 69588683 missense probably damaging 1.00
R1976:Trp53 UTSW 11 69588497 missense probably damaging 1.00
R2070:Trp53 UTSW 11 69589632 missense probably damaging 1.00
R2071:Trp53 UTSW 11 69589632 missense probably damaging 1.00
R2988:Trp53 UTSW 11 69588506 missense probably damaging 1.00
R4698:Trp53 UTSW 11 69588422 nonsense probably null
R4838:Trp53 UTSW 11 69587630 missense probably damaging 1.00
R5269:Trp53 UTSW 11 69589205 missense probably damaging 1.00
R5360:Trp53 UTSW 11 69588740 critical splice donor site probably null
R5399:Trp53 UTSW 11 69588546 missense probably benign 0.19
R5420:Trp53 UTSW 11 69588320 intron probably benign
R5982:Trp53 UTSW 11 69587418 missense probably benign 0.06
R6051:Trp53 UTSW 11 69589608 missense possibly damaging 0.93
R6305:Trp53 UTSW 11 69588707 missense probably damaging 1.00
R6457:Trp53 UTSW 11 69589614 missense probably damaging 1.00
R6947:Trp53 UTSW 11 69588481 missense possibly damaging 0.93
R7278:Trp53 UTSW 11 69591255 missense probably benign 0.00
R7339:Trp53 UTSW 11 69589189 missense probably damaging 1.00
R7418:Trp53 UTSW 11 69588388 missense probably damaging 1.00
R7899:Trp53 UTSW 11 69590693 missense probably damaging 1.00
R8344:Trp53 UTSW 11 69587583 missense probably damaging 1.00
Z1176:Trp53 UTSW 11 69589202 missense probably damaging 1.00
Z1176:Trp53 UTSW 11 69589250 missense probably null 0.94
Z1177:Trp53 UTSW 11 69588362 critical splice acceptor site probably null
Z1177:Trp53 UTSW 11 69589211 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCGACTTCTTGGATACTTGTAAC -3'
(R):5'- CGCAGGATTTACAGACACCC -3'

Sequencing Primer
(F):5'- AACCTAAGTTCTGCCACGTGG -3'
(R):5'- CCCAACACCATACCATGTTTG -3'
Posted On2015-12-29