Incidental Mutation 'R4776:Pafah1b1'
ID367955
Institutional Source Beutler Lab
Gene Symbol Pafah1b1
Ensembl Gene ENSMUSG00000020745
Gene Nameplatelet-activating factor acetylhydrolase, isoform 1b, subunit 1
SynonymsPafaha, lissencephaly-1 protein, Mdsh, PAF-AH 45, LIS-1, Lis1
MMRRC Submission 042413-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4776 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74673949-74724670 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 74685871 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021091] [ENSMUST00000102520] [ENSMUST00000155493]
Predicted Effect probably benign
Transcript: ENSMUST00000021091
SMART Domains Protein: ENSMUSP00000021091
Gene: ENSMUSG00000020745

DomainStartEndE-ValueType
LisH 7 39 6.12e-7 SMART
WD40 97 136 2.1e-7 SMART
WD40 139 178 9.73e-12 SMART
WD40 181 220 1.1e-10 SMART
WD40 223 262 9.3e-9 SMART
WD40 265 324 4.65e-9 SMART
WD40 327 366 4.11e-10 SMART
WD40 369 408 8.81e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102520
SMART Domains Protein: ENSMUSP00000099578
Gene: ENSMUSG00000020745

DomainStartEndE-ValueType
LisH 7 39 6.12e-7 SMART
WD40 97 136 2.1e-7 SMART
WD40 139 178 9.73e-12 SMART
WD40 181 220 1.1e-10 SMART
WD40 223 262 9.3e-9 SMART
WD40 265 324 4.65e-9 SMART
WD40 327 366 4.11e-10 SMART
WD40 369 408 8.81e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126341
Predicted Effect probably benign
Transcript: ENSMUST00000155493
SMART Domains Protein: ENSMUSP00000118231
Gene: ENSMUSG00000020745

DomainStartEndE-ValueType
LisH 7 39 6.12e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156794
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus was identified as encoding a gene that when mutated or lost caused the lissencephaly associated with Miller-Dieker lissencephaly syndrome. This gene encodes the non-catalytic alpha subunit of the intracellular Ib isoform of platelet-activating factor acteylhydrolase, a heterotrimeric enzyme that specifically catalyzes the removal of the acetyl group at the SN-2 position of platelet-activating factor (identified as 1-O-alkyl-2-acetyl-sn-glyceryl-3-phosphorylcholine). Two other isoforms of intracellular platelet-activating factor acetylhydrolase exist: one composed of multiple subunits, the other, a single subunit. In addition, a single-subunit isoform of this enzyme is found in serum. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mutations at this locus result in neuronal migration defects. Homozygous null mutants die around implantation. Different allelic combinations show variable cortical, hippocampal and olfactory disorganization and impaired spatial learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,719,535 Y683* probably null Het
2610028H24Rik A T 10: 76,457,512 M156L probably benign Het
4930470P17Rik C T 2: 170,579,724 A79T unknown Het
4930522L14Rik A G 5: 109,736,873 I373T probably benign Het
A830010M20Rik C A 5: 107,510,451 A1117E probably damaging Het
Amotl1 G A 9: 14,593,373 Q217* probably null Het
Ankrd28 A T 14: 31,732,054 C254S probably damaging Het
Ap2a1 A G 7: 44,901,546 probably benign Het
Arfgef3 A T 10: 18,654,247 S245T probably benign Het
Arntl A T 7: 113,285,037 K94I probably damaging Het
Atp1b2 A T 11: 69,601,561 D224E probably damaging Het
Boc G A 16: 44,487,721 R924W probably damaging Het
Car14 C T 3: 95,898,873 G292D probably benign Het
Cenpb T C 2: 131,178,183 probably benign Het
Ces1b A T 8: 93,063,030 D423E possibly damaging Het
Cfap54 T A 10: 92,972,694 N1373I possibly damaging Het
Chrdl2 T C 7: 100,006,541 probably benign Het
Cic T G 7: 25,282,883 S12A possibly damaging Het
Csmd2 A T 4: 128,442,892 Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 H120R possibly damaging Het
Dicer1 T A 12: 104,692,446 D1779V probably damaging Het
Dock9 G T 14: 121,610,097 H1016N possibly damaging Het
Dxo T C 17: 34,838,998 L352P probably damaging Het
Eif2b5 T A 16: 20,500,233 F78I probably damaging Het
Eri2 A G 7: 119,784,946 probably benign Het
Fam208b A G 13: 3,570,391 F2170S probably damaging Het
Fbxw7 T G 3: 84,925,689 L13V possibly damaging Het
Fgf7 T A 2: 126,035,783 C23* probably null Het
Fubp1 T A 3: 152,222,068 probably null Het
Gm2663 A T 6: 40,995,953 I240N probably damaging Het
Gnb1l C T 16: 18,548,096 Q140* probably null Het
Gnptab G A 10: 88,436,528 R1010Q probably damaging Het
Gtf2h1 G A 7: 46,822,878 W544* probably null Het
Gucy2c C T 6: 136,722,514 E586K probably damaging Het
Hc T A 2: 35,039,734 E232V probably benign Het
Ifi207 T A 1: 173,730,056 D372V unknown Het
Igkv8-28 A T 6: 70,144,118 V15E probably benign Het
Il1rap A G 16: 26,692,799 S198G possibly damaging Het
Lct A G 1: 128,300,387 I1123T probably damaging Het
Lhcgr T C 17: 88,742,697 E467G probably damaging Het
Macf1 C T 4: 123,476,015 R86K probably benign Het
Maml3 T A 3: 51,856,532 Q337L probably benign Het
March10 T A 11: 105,390,037 D474V probably benign Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mast1 A G 8: 84,937,193 probably null Het
Med12l T C 3: 59,233,212 I868T probably damaging Het
Msrb1 T C 17: 24,740,173 S100P probably damaging Het
Nlrp4c T C 7: 6,066,126 L342P probably benign Het
Nrxn3 T A 12: 90,331,956 V417E possibly damaging Het
Ntng1 T A 3: 109,934,713 D248V probably damaging Het
Oaz3 T C 3: 94,434,998 Q117R probably benign Het
Olfr1311 A G 2: 112,020,931 Y308H probably benign Het
Olfr444 A G 6: 42,955,521 I8V probably benign Het
Olfr589 A G 7: 103,155,414 L111P probably benign Het
Osbpl3 A C 6: 50,300,973 S767A probably benign Het
Pard6b A G 2: 168,098,788 T232A probably damaging Het
Paxip1 A T 5: 27,765,206 C596S probably damaging Het
Pnpla6 T C 8: 3,523,818 V422A probably benign Het
Psmd6 A T 14: 14,120,932 probably benign Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sel1l T A 12: 91,813,893 H658L probably damaging Het
Sh3yl1 T A 12: 30,940,314 L105Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sirt1 T C 10: 63,335,722 K227E probably benign Het
Slc25a34 A T 4: 141,623,588 F37I possibly damaging Het
Slc39a5 T A 10: 128,397,049 I378F probably damaging Het
Smarcad1 A T 6: 65,098,824 D731V probably null Het
Sox6 T G 7: 115,541,670 K483N probably damaging Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srgap1 G T 10: 121,792,351 D882E probably benign Het
Syne4 T C 7: 30,316,833 probably benign Het
Tec T C 5: 72,768,776 Y289C probably benign Het
Tmem102 A T 11: 69,804,802 Y115N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav17 T A 14: 53,806,640 M1K probably null Het
Trdn T A 10: 33,399,082 probably null Het
Trp53 A T 11: 69,586,921 I8F probably benign Het
Ttn T A 2: 76,754,662 D22064V probably damaging Het
Ube3c G A 5: 29,632,838 probably null Het
Ulk1 C T 5: 110,788,947 probably null Het
Upp1 T C 11: 9,135,976 V271A probably damaging Het
Vmn2r4 T C 3: 64,388,661 E901G probably damaging Het
Vmn2r96 G A 17: 18,597,508 G449D probably damaging Het
Vps37b T C 5: 124,006,612 K165E probably damaging Het
Vwf A T 6: 125,566,305 I185F possibly damaging Het
Wasf2 A G 4: 133,185,004 T56A probably benign Het
Zdhhc23 C G 16: 43,973,589 D241H possibly damaging Het
Zfp276 T C 8: 123,254,884 S57P probably benign Het
Zxdc A G 6: 90,370,518 H287R probably damaging Het
Other mutations in Pafah1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pafah1b1 APN 11 74683647 missense probably damaging 1.00
IGL01861:Pafah1b1 APN 11 74690577 missense possibly damaging 0.81
IGL02082:Pafah1b1 APN 11 74699333 missense probably benign 0.33
IGL03180:Pafah1b1 APN 11 74683518 missense possibly damaging 0.80
hotspur UTSW 11 74682272 missense probably benign 0.02
picador UTSW 11 74677731 missense probably benign
R0362:Pafah1b1 UTSW 11 74683631 missense probably benign 0.01
R0462:Pafah1b1 UTSW 11 74677715 missense probably benign 0.00
R1962:Pafah1b1 UTSW 11 74699351 start gained probably benign
R3176:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R3276:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R3615:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R3616:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R4326:Pafah1b1 UTSW 11 74682240 missense probably benign 0.04
R4327:Pafah1b1 UTSW 11 74682240 missense probably benign 0.04
R4328:Pafah1b1 UTSW 11 74682240 missense probably benign 0.04
R4985:Pafah1b1 UTSW 11 74685988 missense probably damaging 1.00
R5128:Pafah1b1 UTSW 11 74679436 intron probably benign
R5148:Pafah1b1 UTSW 11 74684452 missense probably damaging 0.99
R6406:Pafah1b1 UTSW 11 74682272 missense probably benign 0.02
R6437:Pafah1b1 UTSW 11 74677731 missense probably benign
R7229:Pafah1b1 UTSW 11 74682278 missense probably damaging 0.99
R7480:Pafah1b1 UTSW 11 74685914 missense probably damaging 1.00
R8115:Pafah1b1 UTSW 11 74684493 missense probably damaging 1.00
X0064:Pafah1b1 UTSW 11 74689183 missense possibly damaging 0.62
Z1176:Pafah1b1 UTSW 11 74689119 missense probably benign 0.01
Z1176:Pafah1b1 UTSW 11 74690241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGGACTAATTCACGTGACCTG -3'
(R):5'- AGACTGGAGATTTTGAGCGAAC -3'

Sequencing Primer
(F):5'- AATTCACGTGACCTGTCAGTTTTTC -3'
(R):5'- TTGAGCGAACTCTCAAGGGC -3'
Posted On2015-12-29