Incidental Mutation 'R4776:Rock2'
ID367957
Institutional Source Beutler Lab
Gene Symbol Rock2
Ensembl Gene ENSMUSG00000020580
Gene NameRho-associated coiled-coil containing protein kinase 2
SynonymsB230113H15Rik, ROKalpha, Rho-kinase, Rock-II, Rock2m
MMRRC Submission 042413-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R4776 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location16894895-16987823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16977740 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1353 (C1353S)
Ref Sequence ENSEMBL: ENSMUSP00000152813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020904] [ENSMUST00000220688]
Predicted Effect probably damaging
Transcript: ENSMUST00000020904
AA Change: C1296S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020904
Gene: ENSMUSG00000020580
AA Change: C1296S

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
S_TKc 92 354 9.2e-96 SMART
S_TK_X 357 417 3.24e-13 SMART
PDB:3O0Z|D 552 717 4e-46 PDB
low complexity region 723 743 N/A INTRINSIC
low complexity region 882 909 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
Pfam:Rho_Binding 978 1046 4.7e-28 PFAM
coiled coil region 1054 1126 N/A INTRINSIC
PH 1151 1351 2.88e-5 SMART
C1 1261 1315 2.21e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220688
AA Change: C1353S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect
Meta Mutation Damage Score 0.9555 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that regulates cytokinesis, smooth muscle contraction, the formation of actin stress fibers and focal adhesions, and the activation of the c-fos serum response element. This protein, which is an isozyme of ROCK1 is a target for the small GTPase Rho. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this genes tend to die before birth; those that survive are small. Hemorrhaging occurs in the placenta, at the tips of hind limb buds and occasionally the tail. Subsequent development is normal and the size deficit is made up. They are fertile as adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,719,535 Y683* probably null Het
2610028H24Rik A T 10: 76,457,512 M156L probably benign Het
4930470P17Rik C T 2: 170,579,724 A79T unknown Het
4930522L14Rik A G 5: 109,736,873 I373T probably benign Het
A830010M20Rik C A 5: 107,510,451 A1117E probably damaging Het
Amotl1 G A 9: 14,593,373 Q217* probably null Het
Ankrd28 A T 14: 31,732,054 C254S probably damaging Het
Ap2a1 A G 7: 44,901,546 probably benign Het
Arfgef3 A T 10: 18,654,247 S245T probably benign Het
Arntl A T 7: 113,285,037 K94I probably damaging Het
Atp1b2 A T 11: 69,601,561 D224E probably damaging Het
Boc G A 16: 44,487,721 R924W probably damaging Het
Car14 C T 3: 95,898,873 G292D probably benign Het
Cenpb T C 2: 131,178,183 probably benign Het
Ces1b A T 8: 93,063,030 D423E possibly damaging Het
Cfap54 T A 10: 92,972,694 N1373I possibly damaging Het
Chrdl2 T C 7: 100,006,541 probably benign Het
Cic T G 7: 25,282,883 S12A possibly damaging Het
Csmd2 A T 4: 128,442,892 Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 H120R possibly damaging Het
Dicer1 T A 12: 104,692,446 D1779V probably damaging Het
Dock9 G T 14: 121,610,097 H1016N possibly damaging Het
Dxo T C 17: 34,838,998 L352P probably damaging Het
Eif2b5 T A 16: 20,500,233 F78I probably damaging Het
Eri2 A G 7: 119,784,946 probably benign Het
Fam208b A G 13: 3,570,391 F2170S probably damaging Het
Fbxw7 T G 3: 84,925,689 L13V possibly damaging Het
Fgf7 T A 2: 126,035,783 C23* probably null Het
Fubp1 T A 3: 152,222,068 probably null Het
Gm2663 A T 6: 40,995,953 I240N probably damaging Het
Gnb1l C T 16: 18,548,096 Q140* probably null Het
Gnptab G A 10: 88,436,528 R1010Q probably damaging Het
Gtf2h1 G A 7: 46,822,878 W544* probably null Het
Gucy2c C T 6: 136,722,514 E586K probably damaging Het
Hc T A 2: 35,039,734 E232V probably benign Het
Ifi207 T A 1: 173,730,056 D372V unknown Het
Igkv8-28 A T 6: 70,144,118 V15E probably benign Het
Il1rap A G 16: 26,692,799 S198G possibly damaging Het
Lct A G 1: 128,300,387 I1123T probably damaging Het
Lhcgr T C 17: 88,742,697 E467G probably damaging Het
Macf1 C T 4: 123,476,015 R86K probably benign Het
Maml3 T A 3: 51,856,532 Q337L probably benign Het
March10 T A 11: 105,390,037 D474V probably benign Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mast1 A G 8: 84,937,193 probably null Het
Med12l T C 3: 59,233,212 I868T probably damaging Het
Msrb1 T C 17: 24,740,173 S100P probably damaging Het
Nlrp4c T C 7: 6,066,126 L342P probably benign Het
Nrxn3 T A 12: 90,331,956 V417E possibly damaging Het
Ntng1 T A 3: 109,934,713 D248V probably damaging Het
Oaz3 T C 3: 94,434,998 Q117R probably benign Het
Olfr1311 A G 2: 112,020,931 Y308H probably benign Het
Olfr444 A G 6: 42,955,521 I8V probably benign Het
Olfr589 A G 7: 103,155,414 L111P probably benign Het
Osbpl3 A C 6: 50,300,973 S767A probably benign Het
Pafah1b1 A T 11: 74,685,871 probably benign Het
Pard6b A G 2: 168,098,788 T232A probably damaging Het
Paxip1 A T 5: 27,765,206 C596S probably damaging Het
Pnpla6 T C 8: 3,523,818 V422A probably benign Het
Psmd6 A T 14: 14,120,932 probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sel1l T A 12: 91,813,893 H658L probably damaging Het
Sh3yl1 T A 12: 30,940,314 L105Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sirt1 T C 10: 63,335,722 K227E probably benign Het
Slc25a34 A T 4: 141,623,588 F37I possibly damaging Het
Slc39a5 T A 10: 128,397,049 I378F probably damaging Het
Smarcad1 A T 6: 65,098,824 D731V probably null Het
Sox6 T G 7: 115,541,670 K483N probably damaging Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srgap1 G T 10: 121,792,351 D882E probably benign Het
Syne4 T C 7: 30,316,833 probably benign Het
Tec T C 5: 72,768,776 Y289C probably benign Het
Tmem102 A T 11: 69,804,802 Y115N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav17 T A 14: 53,806,640 M1K probably null Het
Trdn T A 10: 33,399,082 probably null Het
Trp53 A T 11: 69,586,921 I8F probably benign Het
Ttn T A 2: 76,754,662 D22064V probably damaging Het
Ube3c G A 5: 29,632,838 probably null Het
Ulk1 C T 5: 110,788,947 probably null Het
Upp1 T C 11: 9,135,976 V271A probably damaging Het
Vmn2r4 T C 3: 64,388,661 E901G probably damaging Het
Vmn2r96 G A 17: 18,597,508 G449D probably damaging Het
Vps37b T C 5: 124,006,612 K165E probably damaging Het
Vwf A T 6: 125,566,305 I185F possibly damaging Het
Wasf2 A G 4: 133,185,004 T56A probably benign Het
Zdhhc23 C G 16: 43,973,589 D241H possibly damaging Het
Zfp276 T C 8: 123,254,884 S57P probably benign Het
Zxdc A G 6: 90,370,518 H287R probably damaging Het
Other mutations in Rock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Rock2 APN 12 16978055 missense probably benign 0.11
IGL01565:Rock2 APN 12 16953317 missense possibly damaging 0.62
IGL01637:Rock2 APN 12 16965171 missense probably benign
IGL02164:Rock2 APN 12 16965529 missense probably damaging 1.00
IGL02249:Rock2 APN 12 16971041 unclassified probably benign
IGL02490:Rock2 APN 12 16948563 missense probably damaging 1.00
IGL02815:Rock2 APN 12 16966701 splice site probably benign
IGL02979:Rock2 APN 12 16977940 missense probably benign 0.00
IGL03095:Rock2 APN 12 16953340 missense probably benign 0.00
IGL03198:Rock2 APN 12 16975507 missense probably benign 0.27
R0087:Rock2 UTSW 12 16928966 missense probably benign 0.20
R0189:Rock2 UTSW 12 16959516 splice site probably benign
R0282:Rock2 UTSW 12 16977886 splice site probably benign
R0497:Rock2 UTSW 12 16954953 missense probably benign
R1210:Rock2 UTSW 12 16965469 missense probably damaging 0.96
R1347:Rock2 UTSW 12 16977624 missense possibly damaging 0.70
R1347:Rock2 UTSW 12 16977624 missense possibly damaging 0.70
R1616:Rock2 UTSW 12 16972985 missense probably benign 0.03
R1672:Rock2 UTSW 12 16965652 missense probably benign 0.03
R1815:Rock2 UTSW 12 16972726 missense probably benign 0.01
R1840:Rock2 UTSW 12 16928989 missense probably benign
R2349:Rock2 UTSW 12 16977615 missense probably benign 0.07
R3149:Rock2 UTSW 12 16965091 missense probably damaging 1.00
R3979:Rock2 UTSW 12 16972736 missense probably damaging 1.00
R4030:Rock2 UTSW 12 16975479 missense probably damaging 1.00
R4470:Rock2 UTSW 12 16971275 nonsense probably null
R4492:Rock2 UTSW 12 16977683 missense probably damaging 1.00
R4519:Rock2 UTSW 12 16977737 missense probably damaging 1.00
R4794:Rock2 UTSW 12 16940407 missense probably damaging 1.00
R4908:Rock2 UTSW 12 16959491 missense probably benign 0.00
R5363:Rock2 UTSW 12 16965654 critical splice donor site probably null
R5574:Rock2 UTSW 12 16961641 missense possibly damaging 0.55
R5595:Rock2 UTSW 12 16942809 missense probably damaging 1.00
R6158:Rock2 UTSW 12 16954918 missense probably benign
R6728:Rock2 UTSW 12 16961736 missense probably benign 0.00
R6828:Rock2 UTSW 12 16942959 splice site probably null
R7019:Rock2 UTSW 12 16977740 missense probably damaging 1.00
R7181:Rock2 UTSW 12 16973143 missense probably benign 0.00
R7236:Rock2 UTSW 12 16929002 missense probably damaging 1.00
R7362:Rock2 UTSW 12 16958421 missense probably damaging 1.00
R7593:Rock2 UTSW 12 16958240 missense probably benign 0.00
R7743:Rock2 UTSW 12 16976047 missense probably damaging 1.00
R7782:Rock2 UTSW 12 16971110 missense probably benign 0.17
R7935:Rock2 UTSW 12 16948557 missense probably damaging 1.00
R8012:Rock2 UTSW 12 16942742 missense probably damaging 1.00
R8339:Rock2 UTSW 12 16974860 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGTTTAGCAGTCACTTTCGTC -3'
(R):5'- ACAACAGATTCTTTGCCGACG -3'

Sequencing Primer
(F):5'- ATTCTATATGCCAATGAAGGAGAAAG -3'
(R):5'- CAGATTCTTTGCCGACGATATATC -3'
Posted On2015-12-29