Incidental Mutation 'R4776:Nrxn3'
ID367960
Institutional Source Beutler Lab
Gene Symbol Nrxn3
Ensembl Gene ENSMUSG00000066392
Gene Nameneurexin III
Synonyms4933401A11Rik, 9330112C09Rik, D12Bwg0831e, neurexin III alpha, neurexin III beta, neurexin III alpha, neurexin III beta
MMRRC Submission 042413-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4776 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location88722876-90334935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90331956 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 417 (V417E)
Ref Sequence ENSEMBL: ENSMUSP00000105757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057634] [ENSMUST00000110130] [ENSMUST00000110133] [ENSMUST00000163134] [ENSMUST00000167103] [ENSMUST00000167887] [ENSMUST00000190626]
Predicted Effect probably benign
Transcript: ENSMUST00000057634
SMART Domains Protein: ENSMUSP00000050075
Gene: ENSMUSG00000066392

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110130
AA Change: V417E

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105757
Gene: ENSMUSG00000066392
AA Change: V417E

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamG 107 264 1.14e-17 SMART
Blast:LamG 294 410 6e-47 BLAST
low complexity region 492 507 N/A INTRINSIC
4.1m 510 528 4.38e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110133
SMART Domains Protein: ENSMUSP00000105760
Gene: ENSMUSG00000066392

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamG 107 234 1.8e-20 SMART
Blast:LamG 264 330 1e-19 BLAST
low complexity region 358 373 N/A INTRINSIC
4.1m 376 394 4.38e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163134
AA Change: V1421E

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129678
Gene: ENSMUSG00000066392
AA Change: V1421E

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 843 4.87e-26 SMART
LamG 891 1027 7.08e-37 SMART
EGF 1052 1086 1.99e1 SMART
LamG 1114 1271 1.14e-17 SMART
low complexity region 1312 1328 N/A INTRINSIC
low complexity region 1395 1406 N/A INTRINSIC
low complexity region 1499 1514 N/A INTRINSIC
4.1m 1517 1535 4.38e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167103
SMART Domains Protein: ENSMUSP00000127407
Gene: ENSMUSG00000066392

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 834 5.76e-28 SMART
LamG 882 1018 7.08e-37 SMART
EGF 1043 1077 1.99e1 SMART
LamG 1105 1262 1.14e-17 SMART
low complexity region 1303 1319 N/A INTRINSIC
low complexity region 1354 1382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167887
SMART Domains Protein: ENSMUSP00000127926
Gene: ENSMUSG00000066392

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190626
SMART Domains Protein: ENSMUSP00000139879
Gene: ENSMUSG00000066392

DomainStartEndE-ValueType
LamG 94 246 2.1e-43 SMART
EGF 273 307 2e-4 SMART
LamG 332 470 3.1e-28 SMART
LamG 518 654 4.4e-39 SMART
EGF 688 722 9.6e-2 SMART
LamG 750 877 1.1e-22 SMART
low complexity region 918 934 N/A INTRINSIC
low complexity region 972 1000 N/A INTRINSIC
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. [provided by RefSeq, Dec 2012]
PHENOTYPE: Twenty percent of mice homozygous for a knock-out allele die postnatally prior to 20 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,719,535 Y683* probably null Het
2610028H24Rik A T 10: 76,457,512 M156L probably benign Het
4930470P17Rik C T 2: 170,579,724 A79T unknown Het
4930522L14Rik A G 5: 109,736,873 I373T probably benign Het
A830010M20Rik C A 5: 107,510,451 A1117E probably damaging Het
Amotl1 G A 9: 14,593,373 Q217* probably null Het
Ankrd28 A T 14: 31,732,054 C254S probably damaging Het
Ap2a1 A G 7: 44,901,546 probably benign Het
Arfgef3 A T 10: 18,654,247 S245T probably benign Het
Arntl A T 7: 113,285,037 K94I probably damaging Het
Atp1b2 A T 11: 69,601,561 D224E probably damaging Het
Boc G A 16: 44,487,721 R924W probably damaging Het
Car14 C T 3: 95,898,873 G292D probably benign Het
Cenpb T C 2: 131,178,183 probably benign Het
Ces1b A T 8: 93,063,030 D423E possibly damaging Het
Cfap54 T A 10: 92,972,694 N1373I possibly damaging Het
Chrdl2 T C 7: 100,006,541 probably benign Het
Cic T G 7: 25,282,883 S12A possibly damaging Het
Csmd2 A T 4: 128,442,892 Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 H120R possibly damaging Het
Dicer1 T A 12: 104,692,446 D1779V probably damaging Het
Dock9 G T 14: 121,610,097 H1016N possibly damaging Het
Dxo T C 17: 34,838,998 L352P probably damaging Het
Eif2b5 T A 16: 20,500,233 F78I probably damaging Het
Eri2 A G 7: 119,784,946 probably benign Het
Fam208b A G 13: 3,570,391 F2170S probably damaging Het
Fbxw7 T G 3: 84,925,689 L13V possibly damaging Het
Fgf7 T A 2: 126,035,783 C23* probably null Het
Fubp1 T A 3: 152,222,068 probably null Het
Gm2663 A T 6: 40,995,953 I240N probably damaging Het
Gnb1l C T 16: 18,548,096 Q140* probably null Het
Gnptab G A 10: 88,436,528 R1010Q probably damaging Het
Gtf2h1 G A 7: 46,822,878 W544* probably null Het
Gucy2c C T 6: 136,722,514 E586K probably damaging Het
Hc T A 2: 35,039,734 E232V probably benign Het
Ifi207 T A 1: 173,730,056 D372V unknown Het
Igkv8-28 A T 6: 70,144,118 V15E probably benign Het
Il1rap A G 16: 26,692,799 S198G possibly damaging Het
Lct A G 1: 128,300,387 I1123T probably damaging Het
Lhcgr T C 17: 88,742,697 E467G probably damaging Het
Macf1 C T 4: 123,476,015 R86K probably benign Het
Maml3 T A 3: 51,856,532 Q337L probably benign Het
March10 T A 11: 105,390,037 D474V probably benign Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mast1 A G 8: 84,937,193 probably null Het
Med12l T C 3: 59,233,212 I868T probably damaging Het
Msrb1 T C 17: 24,740,173 S100P probably damaging Het
Nlrp4c T C 7: 6,066,126 L342P probably benign Het
Ntng1 T A 3: 109,934,713 D248V probably damaging Het
Oaz3 T C 3: 94,434,998 Q117R probably benign Het
Olfr1311 A G 2: 112,020,931 Y308H probably benign Het
Olfr444 A G 6: 42,955,521 I8V probably benign Het
Olfr589 A G 7: 103,155,414 L111P probably benign Het
Osbpl3 A C 6: 50,300,973 S767A probably benign Het
Pafah1b1 A T 11: 74,685,871 probably benign Het
Pard6b A G 2: 168,098,788 T232A probably damaging Het
Paxip1 A T 5: 27,765,206 C596S probably damaging Het
Pnpla6 T C 8: 3,523,818 V422A probably benign Het
Psmd6 A T 14: 14,120,932 probably benign Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sel1l T A 12: 91,813,893 H658L probably damaging Het
Sh3yl1 T A 12: 30,940,314 L105Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sirt1 T C 10: 63,335,722 K227E probably benign Het
Slc25a34 A T 4: 141,623,588 F37I possibly damaging Het
Slc39a5 T A 10: 128,397,049 I378F probably damaging Het
Smarcad1 A T 6: 65,098,824 D731V probably null Het
Sox6 T G 7: 115,541,670 K483N probably damaging Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srgap1 G T 10: 121,792,351 D882E probably benign Het
Syne4 T C 7: 30,316,833 probably benign Het
Tec T C 5: 72,768,776 Y289C probably benign Het
Tmem102 A T 11: 69,804,802 Y115N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav17 T A 14: 53,806,640 M1K probably null Het
Trdn T A 10: 33,399,082 probably null Het
Trp53 A T 11: 69,586,921 I8F probably benign Het
Ttn T A 2: 76,754,662 D22064V probably damaging Het
Ube3c G A 5: 29,632,838 probably null Het
Ulk1 C T 5: 110,788,947 probably null Het
Upp1 T C 11: 9,135,976 V271A probably damaging Het
Vmn2r4 T C 3: 64,388,661 E901G probably damaging Het
Vmn2r96 G A 17: 18,597,508 G449D probably damaging Het
Vps37b T C 5: 124,006,612 K165E probably damaging Het
Vwf A T 6: 125,566,305 I185F possibly damaging Het
Wasf2 A G 4: 133,185,004 T56A probably benign Het
Zdhhc23 C G 16: 43,973,589 D241H possibly damaging Het
Zfp276 T C 8: 123,254,884 S57P probably benign Het
Zxdc A G 6: 90,370,518 H287R probably damaging Het
Other mutations in Nrxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrxn3 APN 12 90204592 missense probably damaging 1.00
IGL00961:Nrxn3 APN 12 90204546 missense possibly damaging 0.95
IGL01073:Nrxn3 APN 12 89254740 missense probably benign 0.25
IGL01338:Nrxn3 APN 12 89255034 missense possibly damaging 0.86
IGL01377:Nrxn3 APN 12 89533012 critical splice donor site probably null
IGL01409:Nrxn3 APN 12 89510358 missense probably damaging 1.00
IGL01764:Nrxn3 APN 12 90204750 missense possibly damaging 0.48
IGL02063:Nrxn3 APN 12 88795795 missense possibly damaging 0.86
IGL02171:Nrxn3 APN 12 89193163 missense probably damaging 1.00
IGL02309:Nrxn3 APN 12 89976407 missense probably damaging 0.99
IGL02340:Nrxn3 APN 12 90204628 missense possibly damaging 0.82
IGL02343:Nrxn3 APN 12 88795353 missense probably damaging 1.00
IGL02600:Nrxn3 APN 12 89511912 splice site probably benign
IGL02735:Nrxn3 APN 12 89254854 missense probably benign 0.16
IGL03061:Nrxn3 APN 12 89511928 nonsense probably null
IGL03206:Nrxn3 APN 12 89260508 missense possibly damaging 0.88
IGL03337:Nrxn3 APN 12 89255020 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0144:Nrxn3 UTSW 12 89348392 missense probably damaging 1.00
R0334:Nrxn3 UTSW 12 89813642 critical splice donor site probably null
R0531:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R0840:Nrxn3 UTSW 12 90331793 missense possibly damaging 0.68
R1324:Nrxn3 UTSW 12 89254696 missense possibly damaging 0.89
R1438:Nrxn3 UTSW 12 90332135 missense probably damaging 1.00
R1484:Nrxn3 UTSW 12 89254777 missense probably damaging 0.99
R1621:Nrxn3 UTSW 12 88795710 missense probably benign
R1637:Nrxn3 UTSW 12 89354468 missense possibly damaging 0.94
R1659:Nrxn3 UTSW 12 90332391 missense probably damaging 1.00
R1746:Nrxn3 UTSW 12 89255019 missense possibly damaging 0.63
R1801:Nrxn3 UTSW 12 90283582 missense probably damaging 1.00
R1912:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R1940:Nrxn3 UTSW 12 89260381 missense probably damaging 0.98
R1993:Nrxn3 UTSW 12 89260411 missense possibly damaging 0.59
R2002:Nrxn3 UTSW 12 90332315 missense probably damaging 1.00
R2125:Nrxn3 UTSW 12 89260520 splice site probably null
R2179:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R2207:Nrxn3 UTSW 12 89348312 missense probably damaging 1.00
R2284:Nrxn3 UTSW 12 89510365 missense probably damaging 1.00
R2433:Nrxn3 UTSW 12 89976392 missense probably damaging 1.00
R2969:Nrxn3 UTSW 12 89354471 missense probably damaging 1.00
R3053:Nrxn3 UTSW 12 89255101 missense probably damaging 0.99
R3076:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R3078:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R4033:Nrxn3 UTSW 12 89533001 missense probably damaging 1.00
R4222:Nrxn3 UTSW 12 89532992 nonsense probably null
R4321:Nrxn3 UTSW 12 90199231 missense probably damaging 1.00
R4470:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4471:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4472:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4686:Nrxn3 UTSW 12 89510651 missense probably damaging 0.99
R4821:Nrxn3 UTSW 12 90204709 missense probably damaging 0.99
R4869:Nrxn3 UTSW 12 88795582 missense possibly damaging 0.95
R4910:Nrxn3 UTSW 12 89260360 missense possibly damaging 0.72
R4960:Nrxn3 UTSW 12 88795201 missense possibly damaging 0.79
R4990:Nrxn3 UTSW 12 89260474 missense probably damaging 1.00
R4991:Nrxn3 UTSW 12 89260474 missense probably damaging 1.00
R5057:Nrxn3 UTSW 12 89255034 missense probably damaging 0.99
R5329:Nrxn3 UTSW 12 89813584 missense possibly damaging 0.92
R5888:Nrxn3 UTSW 12 89512085 missense possibly damaging 0.91
R6249:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R6264:Nrxn3 UTSW 12 90332237 missense probably damaging 1.00
R6373:Nrxn3 UTSW 12 89976469 missense probably damaging 1.00
R6401:Nrxn3 UTSW 12 89255000 missense possibly damaging 0.46
R6434:Nrxn3 UTSW 12 88795515 missense probably benign 0.32
R6528:Nrxn3 UTSW 12 89513049 missense probably damaging 1.00
R6612:Nrxn3 UTSW 12 89813332 intron probably benign
R6632:Nrxn3 UTSW 12 89193154 missense probably damaging 1.00
R6874:Nrxn3 UTSW 12 90332190 missense probably damaging 0.99
R7122:Nrxn3 UTSW 12 89510607 missense probably damaging 1.00
R7328:Nrxn3 UTSW 12 88795575 missense probably benign
R7352:Nrxn3 UTSW 12 88850293 missense probably benign
R7425:Nrxn3 UTSW 12 89513100 nonsense probably null
R7444:Nrxn3 UTSW 12 89510694 missense probably damaging 1.00
R7483:Nrxn3 UTSW 12 89510462 missense probably damaging 1.00
R7599:Nrxn3 UTSW 12 89512062 missense probably benign
R7738:Nrxn3 UTSW 12 88850304 missense possibly damaging 0.68
R7765:Nrxn3 UTSW 12 89813484 missense probably benign 0.03
R8139:Nrxn3 UTSW 12 90204664 missense probably benign 0.01
R8192:Nrxn3 UTSW 12 90204795 missense probably benign 0.08
R8351:Nrxn3 UTSW 12 89510643 missense probably damaging 1.00
R8368:Nrxn3 UTSW 12 90332041 nonsense probably null
R8397:Nrxn3 UTSW 12 90331809 missense probably benign 0.17
X0019:Nrxn3 UTSW 12 90199221 missense probably damaging 1.00
Z1176:Nrxn3 UTSW 12 89187055 nonsense probably null
Z1176:Nrxn3 UTSW 12 89517909 missense possibly damaging 0.45
Z1177:Nrxn3 UTSW 12 88795688 missense probably benign 0.00
Z1177:Nrxn3 UTSW 12 89260312 missense probably damaging 1.00
Z1177:Nrxn3 UTSW 12 90331845 missense probably benign 0.05
Z1177:Nrxn3 UTSW 12 90332114 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTAACAGATAAGAGTCTTTCCAC -3'
(R):5'- TCCCTGTTGTACTGCTGGAC -3'

Sequencing Primer
(F):5'- ACTTCAATCTTCGAAGGTGGC -3'
(R):5'- GGAACCCGTCTGATTCCTG -3'
Posted On2015-12-29