Incidental Mutation 'R4776:Dock9'
ID 367967
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission 042413-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4776 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 121847509 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 1016 (H1016N)
Ref Sequence ENSEMBL: ENSMUSP00000148328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040700
AA Change: H1002N

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: H1002N

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100299
AA Change: H1004N

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: H1004N

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212181
AA Change: H1002N

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000212376
AA Change: H1016N

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Meta Mutation Damage Score 0.1368 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,293,346 (GRCm39) M156L probably benign Het
4930470P17Rik C T 2: 170,421,644 (GRCm39) A79T unknown Het
4930522L14Rik A G 5: 109,884,739 (GRCm39) I373T probably benign Het
Amotl1 G A 9: 14,504,669 (GRCm39) Q217* probably null Het
Ankrd28 A T 14: 31,454,011 (GRCm39) C254S probably damaging Het
Ap2a1 A G 7: 44,550,970 (GRCm39) probably benign Het
Arfgef3 A T 10: 18,529,995 (GRCm39) S245T probably benign Het
Atp1b2 A T 11: 69,492,387 (GRCm39) D224E probably damaging Het
Bmal1 A T 7: 112,884,244 (GRCm39) K94I probably damaging Het
Boc G A 16: 44,308,084 (GRCm39) R924W probably damaging Het
Btbd8 C A 5: 107,658,317 (GRCm39) A1117E probably damaging Het
Car14 C T 3: 95,806,185 (GRCm39) G292D probably benign Het
Cenpb T C 2: 131,020,103 (GRCm39) probably benign Het
Ces1b A T 8: 93,789,658 (GRCm39) D423E possibly damaging Het
Cfap54 T A 10: 92,808,556 (GRCm39) N1373I possibly damaging Het
Chrdl2 T C 7: 99,655,748 (GRCm39) probably benign Het
Cic T G 7: 24,982,308 (GRCm39) S12A possibly damaging Het
Csmd2 A T 4: 128,336,685 (GRCm39) Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 (GRCm39) H120R possibly damaging Het
Dicer1 T A 12: 104,658,705 (GRCm39) D1779V probably damaging Het
Dxo T C 17: 35,057,974 (GRCm39) L352P probably damaging Het
Eif2b5 T A 16: 20,318,983 (GRCm39) F78I probably damaging Het
Eri2 A G 7: 119,384,169 (GRCm39) probably benign Het
Fbxw7 T G 3: 84,832,996 (GRCm39) L13V possibly damaging Het
Fgf7 T A 2: 125,877,703 (GRCm39) C23* probably null Het
Fubp1 T A 3: 151,927,705 (GRCm39) probably null Het
Gm2663 A T 6: 40,972,887 (GRCm39) I240N probably damaging Het
Gnb1l C T 16: 18,366,846 (GRCm39) Q140* probably null Het
Gnptab G A 10: 88,272,390 (GRCm39) R1010Q probably damaging Het
Gtf2h1 G A 7: 46,472,302 (GRCm39) W544* probably null Het
Gucy2c C T 6: 136,699,512 (GRCm39) E586K probably damaging Het
Hc T A 2: 34,929,746 (GRCm39) E232V probably benign Het
Ifi207 T A 1: 173,557,622 (GRCm39) D372V unknown Het
Igkv8-28 A T 6: 70,121,102 (GRCm39) V15E probably benign Het
Il1rap A G 16: 26,511,549 (GRCm39) S198G possibly damaging Het
Lct A G 1: 128,228,124 (GRCm39) I1123T probably damaging Het
Lhcgr T C 17: 89,050,125 (GRCm39) E467G probably damaging Het
Macf1 C T 4: 123,369,808 (GRCm39) R86K probably benign Het
Maml3 T A 3: 51,763,953 (GRCm39) Q337L probably benign Het
Marchf10 T A 11: 105,280,863 (GRCm39) D474V probably benign Het
Marchf2 G T 17: 33,928,890 (GRCm39) T2K probably damaging Het
Mast1 A G 8: 85,663,822 (GRCm39) probably null Het
Med12l T C 3: 59,140,633 (GRCm39) I868T probably damaging Het
Msrb1 T C 17: 24,959,147 (GRCm39) S100P probably damaging Het
Nlrp4c T C 7: 6,069,125 (GRCm39) L342P probably benign Het
Nrxn3 T A 12: 90,298,730 (GRCm39) V417E possibly damaging Het
Ntng1 T A 3: 109,842,029 (GRCm39) D248V probably damaging Het
Oaz3 T C 3: 94,342,305 (GRCm39) Q117R probably benign Het
Or2a56 A G 6: 42,932,455 (GRCm39) I8V probably benign Het
Or4f58 A G 2: 111,851,276 (GRCm39) Y308H probably benign Het
Or52e2 A G 7: 102,804,621 (GRCm39) L111P probably benign Het
Osbpl3 A C 6: 50,277,953 (GRCm39) S767A probably benign Het
Pafah1b1 A T 11: 74,576,697 (GRCm39) probably benign Het
Pard6b A G 2: 167,940,708 (GRCm39) T232A probably damaging Het
Paxip1 A T 5: 27,970,204 (GRCm39) C596S probably damaging Het
Pnpla6 T C 8: 3,573,818 (GRCm39) V422A probably benign Het
Psmd6 A T 14: 14,120,932 (GRCm38) probably benign Het
Relch T A 1: 105,647,260 (GRCm39) Y683* probably null Het
Rock2 T A 12: 17,027,741 (GRCm39) C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Sel1l T A 12: 91,780,667 (GRCm39) H658L probably damaging Het
Sh3yl1 T A 12: 30,990,313 (GRCm39) L105Q probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sirt1 T C 10: 63,171,501 (GRCm39) K227E probably benign Het
Slc25a34 A T 4: 141,350,899 (GRCm39) F37I possibly damaging Het
Slc39a5 T A 10: 128,232,918 (GRCm39) I378F probably damaging Het
Smarcad1 A T 6: 65,075,808 (GRCm39) D731V probably null Het
Sox6 T G 7: 115,140,905 (GRCm39) K483N probably damaging Het
Sp140 T A 1: 85,538,549 (GRCm39) D95E possibly damaging Het
Srgap1 G T 10: 121,628,256 (GRCm39) D882E probably benign Het
Syne4 T C 7: 30,016,258 (GRCm39) probably benign Het
Tasor2 A G 13: 3,620,391 (GRCm39) F2170S probably damaging Het
Tec T C 5: 72,926,119 (GRCm39) Y289C probably benign Het
Tmem102 A T 11: 69,695,628 (GRCm39) Y115N probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trav17 T A 14: 54,044,097 (GRCm39) M1K probably null Het
Trdn T A 10: 33,275,078 (GRCm39) probably null Het
Trp53 A T 11: 69,477,747 (GRCm39) I8F probably benign Het
Ttn T A 2: 76,585,006 (GRCm39) D22064V probably damaging Het
Ube3c G A 5: 29,837,836 (GRCm39) probably null Het
Ulk1 C T 5: 110,936,813 (GRCm39) probably null Het
Upp1 T C 11: 9,085,976 (GRCm39) V271A probably damaging Het
Vmn2r4 T C 3: 64,296,082 (GRCm39) E901G probably damaging Het
Vmn2r96 G A 17: 18,817,770 (GRCm39) G449D probably damaging Het
Vps37b T C 5: 124,144,675 (GRCm39) K165E probably damaging Het
Vwf A T 6: 125,543,268 (GRCm39) I185F possibly damaging Het
Wasf2 A G 4: 132,912,315 (GRCm39) T56A probably benign Het
Zdhhc23 C G 16: 43,793,952 (GRCm39) D241H possibly damaging Het
Zfp276 T C 8: 123,981,623 (GRCm39) S57P probably benign Het
Zxdc A G 6: 90,347,500 (GRCm39) H287R probably damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1214:Dock9 UTSW 14 121,823,728 (GRCm39) missense probably benign 0.02
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121,889,187 (GRCm39) missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1855:Dock9 UTSW 14 121,877,571 (GRCm39) missense probably damaging 1.00
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4647:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5151:Dock9 UTSW 14 121,815,582 (GRCm39) missense probably damaging 1.00
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R5890:Dock9 UTSW 14 121,905,820 (GRCm39) critical splice donor site probably null
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6321:Dock9 UTSW 14 121,783,433 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6838:Dock9 UTSW 14 121,784,008 (GRCm39) missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R8900:Dock9 UTSW 14 121,817,940 (GRCm39) missense probably damaging 1.00
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9233:Dock9 UTSW 14 121,820,781 (GRCm39) missense probably benign 0.09
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9451:Dock9 UTSW 14 121,787,601 (GRCm39) splice site probably benign
R9461:Dock9 UTSW 14 121,842,601 (GRCm39) missense probably benign 0.05
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9542:Dock9 UTSW 14 121,864,775 (GRCm39) missense probably damaging 1.00
R9694:Dock9 UTSW 14 121,818,791 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9703:Dock9 UTSW 14 121,781,989 (GRCm39) makesense probably null
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCTCTCCTGTCAGAGTAC -3'
(R):5'- TTACCAGACTGCATTAGGAAGG -3'

Sequencing Primer
(F):5'- TGGAGGTCACTACCTTGA -3'
(R):5'- CCAGACTGCATTAGGAAGGGTATATC -3'
Posted On 2015-12-29