Mutagenetix > Incidental Mutation

Incidental Mutation 'R4776:Tns2'

367968

Institutional Source

Beutler Lab

Gene Symbol

Tns2

Ensembl Gene

ENSMUSG00000037003

Gene Name

tensin 2

Synonyms

nph, nep, Tenc1

MMRRC Submission

042413-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4776 (G1)

Quality Score

140

Status

Validated

Chromosome

Chromosomal Location

102100413-102116401 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 102108934 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 281 (R281C)

Ref Sequence

ENSEMBL: ENSMUSP00000155830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000229592] [ENSMUST00000230474]

AlphaFold

Q8CGB6

Predicted Effect

probably damaging
Transcript: ENSMUST00000046144
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003
AA Change: R281C

Domain	Start	End	E-Value	Type
C1	32	79	2.78e-9	SMART
SCOP:d1d5ra2	128	295	8e-24	SMART
PTEN_C2	297	424	6.63e-40	SMART
low complexity region	494	513	N/A	INTRINSIC
SH2	1136	1236	1.69e-16	SMART
PTB	1269	1407	6.66e-28	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000169627
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003
AA Change: R281C

Domain	Start	End	E-Value	Type
C1	32	79	2.78e-9	SMART
SCOP:d1d5ra2	128	295	8e-24	SMART
PTEN_C2	297	424	6.63e-40	SMART
low complexity region	494	513	N/A	INTRINSIC
SH2	1129	1229	1.69e-16	SMART
PTB	1262	1400	6.66e-28	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000228958
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229035

Predicted Effect

probably benign
Transcript: ENSMUST00000229592

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229908

Predicted Effect

probably damaging
Transcript: ENSMUST00000230474
AA Change: R273C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.2021

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

98% (94/96)

MGI Phenotype

Strain: 2447990
Lethality: D70-D210
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tensin family. Tensin is a focal adhesion molecule that binds to actin filaments and participates in signaling pathways. This protein plays a role in regulating cell migration. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Affected mice homozygous for a spontaneous deletion show reduced female fertility, increased blood urea nitrogen, low hematocrit, proteinuria, hypoproteinemia, hypercholesterolemia, small kidneys with a yellowish granular surface, glomerular lesions and premature death; some develop systemic edema. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,719,535	Y683*	probably null	Het
2610028H24Rik	A	T	10: 76,457,512	M156L	probably benign	Het
4930470P17Rik	C	T	2: 170,579,724	A79T	unknown	Het
4930522L14Rik	A	G	5: 109,736,873	I373T	probably benign	Het
A830010M20Rik	C	A	5: 107,510,451	A1117E	probably damaging	Het
Amotl1	G	A	9: 14,593,373	Q217*	probably null	Het
Ankrd28	A	T	14: 31,732,054	C254S	probably damaging	Het
Ap2a1	A	G	7: 44,901,546		probably benign	Het
Arfgef3	A	T	10: 18,654,247	S245T	probably benign	Het
Arntl	A	T	7: 113,285,037	K94I	probably damaging	Het
Atp1b2	A	T	11: 69,601,561	D224E	probably damaging	Het
Boc	G	A	16: 44,487,721	R924W	probably damaging	Het
Car14	C	T	3: 95,898,873	G292D	probably benign	Het
Cenpb	T	C	2: 131,178,183		probably benign	Het
Ces1b	A	T	8: 93,063,030	D423E	possibly damaging	Het
Cfap54	T	A	10: 92,972,694	N1373I	possibly damaging	Het
Chrdl2	T	C	7: 100,006,541		probably benign	Het
Cic	T	G	7: 25,282,883	S12A	possibly damaging	Het
Csmd2	A	T	4: 128,442,892	Q1421L	probably benign	Het
D630039A03Rik	T	C	4: 57,910,452	H120R	possibly damaging	Het
Dicer1	T	A	12: 104,692,446	D1779V	probably damaging	Het
Dock9	G	T	14: 121,610,097	H1016N	possibly damaging	Het
Dxo	T	C	17: 34,838,998	L352P	probably damaging	Het
Eif2b5	T	A	16: 20,500,233	F78I	probably damaging	Het
Eri2	A	G	7: 119,784,946		probably benign	Het
Fam208b	A	G	13: 3,570,391	F2170S	probably damaging	Het
Fbxw7	T	G	3: 84,925,689	L13V	possibly damaging	Het
Fgf7	T	A	2: 126,035,783	C23*	probably null	Het
Fubp1	T	A	3: 152,222,068		probably null	Het
Gm2663	A	T	6: 40,995,953	I240N	probably damaging	Het
Gnb1l	C	T	16: 18,548,096	Q140*	probably null	Het
Gnptab	G	A	10: 88,436,528	R1010Q	probably damaging	Het
Gtf2h1	G	A	7: 46,822,878	W544*	probably null	Het
Gucy2c	C	T	6: 136,722,514	E586K	probably damaging	Het
Hc	T	A	2: 35,039,734	E232V	probably benign	Het
Ifi207	T	A	1: 173,730,056	D372V	unknown	Het
Igkv8-28	A	T	6: 70,144,118	V15E	probably benign	Het
Il1rap	A	G	16: 26,692,799	S198G	possibly damaging	Het
Lct	A	G	1: 128,300,387	I1123T	probably damaging	Het
Lhcgr	T	C	17: 88,742,697	E467G	probably damaging	Het
Macf1	C	T	4: 123,476,015	R86K	probably benign	Het
Maml3	T	A	3: 51,856,532	Q337L	probably benign	Het
March10	T	A	11: 105,390,037	D474V	probably benign	Het
March2	G	T	17: 33,709,916	T2K	probably damaging	Het
Mast1	A	G	8: 84,937,193		probably null	Het
Med12l	T	C	3: 59,233,212	I868T	probably damaging	Het
Msrb1	T	C	17: 24,740,173	S100P	probably damaging	Het
Nlrp4c	T	C	7: 6,066,126	L342P	probably benign	Het
Nrxn3	T	A	12: 90,331,956	V417E	possibly damaging	Het
Ntng1	T	A	3: 109,934,713	D248V	probably damaging	Het
Oaz3	T	C	3: 94,434,998	Q117R	probably benign	Het
Olfr1311	A	G	2: 112,020,931	Y308H	probably benign	Het
Olfr444	A	G	6: 42,955,521	I8V	probably benign	Het
Olfr589	A	G	7: 103,155,414	L111P	probably benign	Het
Osbpl3	A	C	6: 50,300,973	S767A	probably benign	Het
Pafah1b1	A	T	11: 74,685,871		probably benign	Het
Pard6b	A	G	2: 168,098,788	T232A	probably damaging	Het
Paxip1	A	T	5: 27,765,206	C596S	probably damaging	Het
Pnpla6	T	C	8: 3,523,818	V422A	probably benign	Het
Psmd6	A	T	14: 14,120,932		probably benign	Het
Rock2	T	A	12: 16,977,740	C1353S	probably damaging	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Sel1l	T	A	12: 91,813,893	H658L	probably damaging	Het
Sh3yl1	T	A	12: 30,940,314	L105Q	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sirt1	T	C	10: 63,335,722	K227E	probably benign	Het
Slc25a34	A	T	4: 141,623,588	F37I	possibly damaging	Het
Slc39a5	T	A	10: 128,397,049	I378F	probably damaging	Het
Smarcad1	A	T	6: 65,098,824	D731V	probably null	Het
Sox6	T	G	7: 115,541,670	K483N	probably damaging	Het
Sp140	T	A	1: 85,610,828	D95E	possibly damaging	Het
Srgap1	G	T	10: 121,792,351	D882E	probably benign	Het
Syne4	T	C	7: 30,316,833		probably benign	Het
Tec	T	C	5: 72,768,776	Y289C	probably benign	Het
Tmem102	A	T	11: 69,804,802	Y115N	probably damaging	Het
Trav17	T	A	14: 53,806,640	M1K	probably null	Het
Trdn	T	A	10: 33,399,082		probably null	Het
Trp53	A	T	11: 69,586,921	I8F	probably benign	Het
Ttn	T	A	2: 76,754,662	D22064V	probably damaging	Het
Ube3c	G	A	5: 29,632,838		probably null	Het
Ulk1	C	T	5: 110,788,947		probably null	Het
Upp1	T	C	11: 9,135,976	V271A	probably damaging	Het
Vmn2r4	T	C	3: 64,388,661	E901G	probably damaging	Het
Vmn2r96	G	A	17: 18,597,508	G449D	probably damaging	Het
Vps37b	T	C	5: 124,006,612	K165E	probably damaging	Het
Vwf	A	T	6: 125,566,305	I185F	possibly damaging	Het
Wasf2	A	G	4: 133,185,004	T56A	probably benign	Het
Zdhhc23	C	G	16: 43,973,589	D241H	possibly damaging	Het
Zfp276	T	C	8: 123,254,884	S57P	probably benign	Het
Zxdc	A	G	6: 90,370,518	H287R	probably damaging	Het

Other mutations in Tns2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01575:Tns2	APN	15	102113191	missense	probably damaging	1.00
IGL01935:Tns2	APN	15	102111634	splice site	probably null
IGL01994:Tns2	APN	15	102111379	missense	possibly damaging	0.81
IGL02025:Tns2	APN	15	102112049	nonsense	probably null
IGL02135:Tns2	APN	15	102113026	missense	probably damaging	1.00
IGL02355:Tns2	APN	15	102112290	missense	probably benign
IGL02362:Tns2	APN	15	102112290	missense	probably benign
IGL02439:Tns2	APN	15	102114543	missense	probably damaging	1.00
IGL02488:Tns2	APN	15	102112743	missense	probably benign
IGL02546:Tns2	APN	15	102110940	missense	probably damaging	1.00
IGL02616:Tns2	APN	15	102111415	missense	probably benign
IGL02628:Tns2	APN	15	102111828	missense	probably benign	0.04
IGL02658:Tns2	APN	15	102107796	splice site	probably benign
IGL03267:Tns2	APN	15	102105378	critical splice donor site	probably null
P0005:Tns2	UTSW	15	102114056	missense	probably damaging	0.98
R0586:Tns2	UTSW	15	102109585	splice site	probably benign
R0791:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0817:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0818:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0819:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0820:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1451:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1452:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1453:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1454:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1455:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1487:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1510:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1579:Tns2	UTSW	15	102111210	missense	probably damaging	1.00
R1698:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1772:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1779:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1843:Tns2	UTSW	15	102113133	splice site	probably null
R1923:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1924:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1927:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1980:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2051:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2087:Tns2	UTSW	15	102107119	missense	possibly damaging	0.70
R2100:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2103:Tns2	UTSW	15	102112665	critical splice acceptor site	probably null
R2105:Tns2	UTSW	15	102107506	missense	probably benign	0.27
R2224:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2225:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2227:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2252:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2253:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2290:Tns2	UTSW	15	102112023	missense	probably damaging	0.99
R2304:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2318:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2446:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2447:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2448:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2566:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2567:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2897:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2898:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3159:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3160:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3162:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3162:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3196:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3237:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3426:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3427:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3428:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3695:Tns2	UTSW	15	102112749	missense	probably null
R3767:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3911:Tns2	UTSW	15	102113837	critical splice donor site	probably null
R4113:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4157:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4394:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4395:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4396:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4439:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4441:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4537:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4538:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4541:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4599:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4600:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4602:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4773:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4774:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4775:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4880:Tns2	UTSW	15	102112039	missense	probably damaging	0.98
R4989:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5014:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5058:Tns2	UTSW	15	102107860	missense	possibly damaging	0.68
R5253:Tns2	UTSW	15	102111453	missense	probably damaging	1.00
R5336:Tns2	UTSW	15	102111229	missense	probably damaging	1.00
R5351:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5452:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5453:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5629:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5630:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5631:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5685:Tns2	UTSW	15	102107103	missense	probably benign	0.02
R5844:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6048:Tns2	UTSW	15	102111411	missense	probably damaging	1.00
R6067:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6079:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6130:Tns2	UTSW	15	102111241	missense	probably damaging	1.00
R6136:Tns2	UTSW	15	102107030	missense	probably damaging	1.00
R6138:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6199:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6210:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6426:Tns2	UTSW	15	102107037	missense	possibly damaging	0.65
R6544:Tns2	UTSW	15	102113834	missense	possibly damaging	0.93
R6594:Tns2	UTSW	15	102110559	missense	probably benign	0.00
R6596:Tns2	UTSW	15	102110559	missense	probably benign	0.00
R6734:Tns2	UTSW	15	102103116	missense	probably damaging	0.96
R7061:Tns2	UTSW	15	102104479	start codon destroyed	probably null
R7070:Tns2	UTSW	15	102104533	missense	possibly damaging	0.58
R7110:Tns2	UTSW	15	102105366	missense	probably damaging	0.99
R7410:Tns2	UTSW	15	102110526	missense	probably damaging	1.00
R7447:Tns2	UTSW	15	102110916	missense	probably damaging	1.00
R7751:Tns2	UTSW	15	102109728	missense	probably benign	0.02
R8052:Tns2	UTSW	15	102112845	missense	probably damaging	1.00
R8114:Tns2	UTSW	15	102111390	missense	probably benign	0.01
R8906:Tns2	UTSW	15	102111604	missense	probably damaging	1.00
R8964:Tns2	UTSW	15	102103118	missense	possibly damaging	0.73
R9192:Tns2	UTSW	15	102112981	missense	probably damaging	1.00
R9273:Tns2	UTSW	15	102113043	missense	probably damaging	1.00
R9307:Tns2	UTSW	15	102110561	missense	probably damaging	0.97
R9402:Tns2	UTSW	15	102113188	missense	probably damaging	0.99
R9612:Tns2	UTSW	15	102107142	missense	probably damaging	1.00
R9655:Tns2	UTSW	15	102104498	missense	probably benign	0.03
U15987:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
X0009:Tns2	UTSW	15	102112465	missense	possibly damaging	0.94
X0026:Tns2	UTSW	15	102110502	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGGGAGTTCCTCTGTACAG -3'
(R):5'- CTGTGGAGTCTTTCTTACAAGC -3'

Sequencing Primer
(F):5'- CTGTACAGAGGATCTCATGATTCC -3'
(R):5'- GCCAGAACGATCTAGTCTGTTTACG -3'

Posted On

2015-12-29