Mutagenetix > Incidental Mutation

Incidental Mutation 'R4776:Eif2b5'

367970

Institutional Source

Beutler Lab

Gene Symbol

Eif2b5

Ensembl Gene

ENSMUSG00000003235

Gene Name

eukaryotic translation initiation factor 2B, subunit 5 epsilon

Synonyms

MMRRC Submission

042413-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R4776 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20498817-20509323 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20500233 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 78 (F78I)

Ref Sequence

ENSEMBL: ENSMUSP00000003320 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003320]

AlphaFold

Q8CHW4

Predicted Effect

probably damaging
Transcript: ENSMUST00000003320
AA Change: F78I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000003320
Gene: ENSMUSG00000003235
AA Change: F78I

Domain	Start	End	E-Value	Type
low complexity region	2	31	N/A	INTRINSIC
Pfam:Hexapep	341	372	9.8e-5	PFAM
Pfam:Hexapep	361	389	6.1e-6	PFAM
low complexity region	517	526	N/A	INTRINSIC
eIF5C	625	712	8.43e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000231315

Meta Mutation Damage Score

0.5546

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

98% (94/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of five subunits of eukaryotic translation initiation factor 2B (EIF2B), a GTP exchange factor for eukaryotic initiation factor 2 and an essential regulator for protein synthesis. Mutations in this gene and the genes encoding other EIF2B subunits have been associated with leukoencephalopathy with vanishing white matter. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal brain white matter development, decreased body fat, demyelination, impaired recovery from cuprizone-induced demyelination, and impaired coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,719,535	Y683*	probably null	Het
2610028H24Rik	A	T	10: 76,457,512	M156L	probably benign	Het
4930470P17Rik	C	T	2: 170,579,724	A79T	unknown	Het
4930522L14Rik	A	G	5: 109,736,873	I373T	probably benign	Het
A830010M20Rik	C	A	5: 107,510,451	A1117E	probably damaging	Het
Amotl1	G	A	9: 14,593,373	Q217*	probably null	Het
Ankrd28	A	T	14: 31,732,054	C254S	probably damaging	Het
Ap2a1	A	G	7: 44,901,546		probably benign	Het
Arfgef3	A	T	10: 18,654,247	S245T	probably benign	Het
Arntl	A	T	7: 113,285,037	K94I	probably damaging	Het
Atp1b2	A	T	11: 69,601,561	D224E	probably damaging	Het
Boc	G	A	16: 44,487,721	R924W	probably damaging	Het
Car14	C	T	3: 95,898,873	G292D	probably benign	Het
Cenpb	T	C	2: 131,178,183		probably benign	Het
Ces1b	A	T	8: 93,063,030	D423E	possibly damaging	Het
Cfap54	T	A	10: 92,972,694	N1373I	possibly damaging	Het
Chrdl2	T	C	7: 100,006,541		probably benign	Het
Cic	T	G	7: 25,282,883	S12A	possibly damaging	Het
Csmd2	A	T	4: 128,442,892	Q1421L	probably benign	Het
D630039A03Rik	T	C	4: 57,910,452	H120R	possibly damaging	Het
Dicer1	T	A	12: 104,692,446	D1779V	probably damaging	Het
Dock9	G	T	14: 121,610,097	H1016N	possibly damaging	Het
Dxo	T	C	17: 34,838,998	L352P	probably damaging	Het
Eri2	A	G	7: 119,784,946		probably benign	Het
Fam208b	A	G	13: 3,570,391	F2170S	probably damaging	Het
Fbxw7	T	G	3: 84,925,689	L13V	possibly damaging	Het
Fgf7	T	A	2: 126,035,783	C23*	probably null	Het
Fubp1	T	A	3: 152,222,068		probably null	Het
Gm2663	A	T	6: 40,995,953	I240N	probably damaging	Het
Gnb1l	C	T	16: 18,548,096	Q140*	probably null	Het
Gnptab	G	A	10: 88,436,528	R1010Q	probably damaging	Het
Gtf2h1	G	A	7: 46,822,878	W544*	probably null	Het
Gucy2c	C	T	6: 136,722,514	E586K	probably damaging	Het
Hc	T	A	2: 35,039,734	E232V	probably benign	Het
Ifi207	T	A	1: 173,730,056	D372V	unknown	Het
Igkv8-28	A	T	6: 70,144,118	V15E	probably benign	Het
Il1rap	A	G	16: 26,692,799	S198G	possibly damaging	Het
Lct	A	G	1: 128,300,387	I1123T	probably damaging	Het
Lhcgr	T	C	17: 88,742,697	E467G	probably damaging	Het
Macf1	C	T	4: 123,476,015	R86K	probably benign	Het
Maml3	T	A	3: 51,856,532	Q337L	probably benign	Het
March10	T	A	11: 105,390,037	D474V	probably benign	Het
March2	G	T	17: 33,709,916	T2K	probably damaging	Het
Mast1	A	G	8: 84,937,193		probably null	Het
Med12l	T	C	3: 59,233,212	I868T	probably damaging	Het
Msrb1	T	C	17: 24,740,173	S100P	probably damaging	Het
Nlrp4c	T	C	7: 6,066,126	L342P	probably benign	Het
Nrxn3	T	A	12: 90,331,956	V417E	possibly damaging	Het
Ntng1	T	A	3: 109,934,713	D248V	probably damaging	Het
Oaz3	T	C	3: 94,434,998	Q117R	probably benign	Het
Olfr1311	A	G	2: 112,020,931	Y308H	probably benign	Het
Olfr444	A	G	6: 42,955,521	I8V	probably benign	Het
Olfr589	A	G	7: 103,155,414	L111P	probably benign	Het
Osbpl3	A	C	6: 50,300,973	S767A	probably benign	Het
Pafah1b1	A	T	11: 74,685,871		probably benign	Het
Pard6b	A	G	2: 168,098,788	T232A	probably damaging	Het
Paxip1	A	T	5: 27,765,206	C596S	probably damaging	Het
Pnpla6	T	C	8: 3,523,818	V422A	probably benign	Het
Psmd6	A	T	14: 14,120,932		probably benign	Het
Rock2	T	A	12: 16,977,740	C1353S	probably damaging	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Sel1l	T	A	12: 91,813,893	H658L	probably damaging	Het
Sh3yl1	T	A	12: 30,940,314	L105Q	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sirt1	T	C	10: 63,335,722	K227E	probably benign	Het
Slc25a34	A	T	4: 141,623,588	F37I	possibly damaging	Het
Slc39a5	T	A	10: 128,397,049	I378F	probably damaging	Het
Smarcad1	A	T	6: 65,098,824	D731V	probably null	Het
Sox6	T	G	7: 115,541,670	K483N	probably damaging	Het
Sp140	T	A	1: 85,610,828	D95E	possibly damaging	Het
Srgap1	G	T	10: 121,792,351	D882E	probably benign	Het
Syne4	T	C	7: 30,316,833		probably benign	Het
Tec	T	C	5: 72,768,776	Y289C	probably benign	Het
Tmem102	A	T	11: 69,804,802	Y115N	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trav17	T	A	14: 53,806,640	M1K	probably null	Het
Trdn	T	A	10: 33,399,082		probably null	Het
Trp53	A	T	11: 69,586,921	I8F	probably benign	Het
Ttn	T	A	2: 76,754,662	D22064V	probably damaging	Het
Ube3c	G	A	5: 29,632,838		probably null	Het
Ulk1	C	T	5: 110,788,947		probably null	Het
Upp1	T	C	11: 9,135,976	V271A	probably damaging	Het
Vmn2r4	T	C	3: 64,388,661	E901G	probably damaging	Het
Vmn2r96	G	A	17: 18,597,508	G449D	probably damaging	Het
Vps37b	T	C	5: 124,006,612	K165E	probably damaging	Het
Vwf	A	T	6: 125,566,305	I185F	possibly damaging	Het
Wasf2	A	G	4: 133,185,004	T56A	probably benign	Het
Zdhhc23	C	G	16: 43,973,589	D241H	possibly damaging	Het
Zfp276	T	C	8: 123,254,884	S57P	probably benign	Het
Zxdc	A	G	6: 90,370,518	H287R	probably damaging	Het

Other mutations in Eif2b5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Eif2b5	APN	16	20505252	missense	probably benign	0.19
IGL01073:Eif2b5	APN	16	20500296	nonsense	probably null
IGL01467:Eif2b5	APN	16	20508964	nonsense	probably null
IGL02754:Eif2b5	APN	16	20502786	missense	possibly damaging	0.50
IGL03286:Eif2b5	APN	16	20502262	missense	probably damaging	1.00
R0569:Eif2b5	UTSW	16	20502553	missense	probably benign	0.13
R1321:Eif2b5	UTSW	16	20504689	nonsense	probably null
R1647:Eif2b5	UTSW	16	20502585	missense	possibly damaging	0.77
R1648:Eif2b5	UTSW	16	20502585	missense	possibly damaging	0.77
R1897:Eif2b5	UTSW	16	20507037	missense	probably damaging	0.99
R2231:Eif2b5	UTSW	16	20504770	missense	probably benign
R3196:Eif2b5	UTSW	16	20505522	missense	probably benign
R4423:Eif2b5	UTSW	16	20501719	missense	probably benign	0.10
R5240:Eif2b5	UTSW	16	20501398	missense	possibly damaging	0.49
R5828:Eif2b5	UTSW	16	20502786	missense	possibly damaging	0.50
R5920:Eif2b5	UTSW	16	20498944	missense	unknown
R5925:Eif2b5	UTSW	16	20508124	missense	probably benign	0.02
R6717:Eif2b5	UTSW	16	20505283	missense	probably damaging	0.96
R6915:Eif2b5	UTSW	16	20502750	missense	possibly damaging	0.83
R7396:Eif2b5	UTSW	16	20506137	missense	possibly damaging	0.69
R8046:Eif2b5	UTSW	16	20506404	missense	possibly damaging	0.88
R8196:Eif2b5	UTSW	16	20502556	missense	probably damaging	0.99
R8503:Eif2b5	UTSW	16	20498980	missense	probably benign	0.23
R8532:Eif2b5	UTSW	16	20505206	missense	probably damaging	0.99
R9222:Eif2b5	UTSW	16	20502632	nonsense	probably null
R9336:Eif2b5	UTSW	16	20505277	missense	probably damaging	1.00
Z1187:Eif2b5	UTSW	16	20498921	missense	unknown
Z1192:Eif2b5	UTSW	16	20498921	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCTTAGAGCCTGTTTGCTTTAG -3'
(R):5'- GGAAGCTGCAGCAGTTTACC -3'

Sequencing Primer
(F):5'- GAGCCTGTTTGCTTTAGAATAAAAGG -3'
(R):5'- AGTTTACCTCGGGACACGTGAC -3'

Posted On

2015-12-29