Incidental Mutation 'R4776:Dxo'
ID367977
Institutional Source Beutler Lab
Gene Symbol Dxo
Ensembl Gene ENSMUSG00000040482
Gene Namedecapping exoribonuclease
SynonymsDom3z
MMRRC Submission 042413-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R4776 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34837019-34839233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34838998 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 352 (L352P)
Ref Sequence ENSEMBL: ENSMUSP00000137234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046022] [ENSMUST00000046244] [ENSMUST00000077477] [ENSMUST00000159333] [ENSMUST00000161885] [ENSMUST00000172612] [ENSMUST00000173063] [ENSMUST00000173415] [ENSMUST00000173768] [ENSMUST00000174092] [ENSMUST00000180043] [ENSMUST00000173995] [ENSMUST00000173874]
Predicted Effect probably benign
Transcript: ENSMUST00000046022
SMART Domains Protein: ENSMUSP00000036265
Gene: ENSMUSG00000040356

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 171 176 N/A INTRINSIC
low complexity region 208 237 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
DEXDc 304 487 3.61e-28 SMART
low complexity region 583 592 N/A INTRINSIC
HELICc 619 705 8.63e-17 SMART
Pfam:rRNA_proc-arch 760 1044 9.7e-39 PFAM
DSHCT 1067 1243 7.67e-77 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000046244
AA Change: L352P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047018
Gene: ENSMUSG00000040482
AA Change: L352P

DomainStartEndE-ValueType
low complexity region 168 184 N/A INTRINSIC
Pfam:RAI1 235 303 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077477
SMART Domains Protein: ENSMUSP00000076686
Gene: ENSMUSG00000061207

DomainStartEndE-ValueType
Pfam:Stk19 37 251 1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159333
SMART Domains Protein: ENSMUSP00000125311
Gene: ENSMUSG00000061207

DomainStartEndE-ValueType
Pfam:Stk19 1 129 3.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161238
Predicted Effect probably benign
Transcript: ENSMUST00000161885
Predicted Effect probably benign
Transcript: ENSMUST00000172612
SMART Domains Protein: ENSMUSP00000133376
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
Pfam:RAI1 5 73 1.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172878
Predicted Effect probably benign
Transcript: ENSMUST00000173063
Predicted Effect probably benign
Transcript: ENSMUST00000173415
SMART Domains Protein: ENSMUSP00000134209
Gene: ENSMUSG00000040356

DomainStartEndE-ValueType
PDB:4A4Z|A 10 81 8e-14 PDB
Blast:DEXDc 19 76 2e-29 BLAST
Blast:DEXDc 136 242 9e-28 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173768
SMART Domains Protein: ENSMUSP00000134052
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
Pfam:RAI1 1 33 5.6e-15 PFAM
low complexity region 54 64 N/A INTRINSIC
low complexity region 73 88 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174092
AA Change: L200P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133587
Gene: ENSMUSG00000040482
AA Change: L200P

DomainStartEndE-ValueType
Pfam:RAI1 110 151 5.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180043
AA Change: L352P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137234
Gene: ENSMUSG00000040482
AA Change: L352P

DomainStartEndE-ValueType
low complexity region 168 184 N/A INTRINSIC
Pfam:RAI1 235 302 2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183497
Predicted Effect probably benign
Transcript: ENSMUST00000174569
SMART Domains Protein: ENSMUSP00000133448
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
Pfam:RAI1 15 65 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173995
SMART Domains Protein: ENSMUSP00000134583
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
PDB:3FQJ|A 1 144 5e-99 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174684
SMART Domains Protein: ENSMUSP00000134653
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
PDB:3FQJ|A 2 48 1e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000173874
SMART Domains Protein: ENSMUSP00000134332
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
low complexity region 168 184 N/A INTRINSIC
Pfam:RAI1 235 303 4.2e-29 PFAM
Meta Mutation Damage Score 0.7888 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. The function of its protein product is unknown, but its ubiquitous expression and conservation in both simple and complex eukaryotes suggests that this may be a housekeeping gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,719,535 Y683* probably null Het
2610028H24Rik A T 10: 76,457,512 M156L probably benign Het
4930470P17Rik C T 2: 170,579,724 A79T unknown Het
4930522L14Rik A G 5: 109,736,873 I373T probably benign Het
A830010M20Rik C A 5: 107,510,451 A1117E probably damaging Het
Amotl1 G A 9: 14,593,373 Q217* probably null Het
Ankrd28 A T 14: 31,732,054 C254S probably damaging Het
Ap2a1 A G 7: 44,901,546 probably benign Het
Arfgef3 A T 10: 18,654,247 S245T probably benign Het
Arntl A T 7: 113,285,037 K94I probably damaging Het
Atp1b2 A T 11: 69,601,561 D224E probably damaging Het
Boc G A 16: 44,487,721 R924W probably damaging Het
Car14 C T 3: 95,898,873 G292D probably benign Het
Cenpb T C 2: 131,178,183 probably benign Het
Ces1b A T 8: 93,063,030 D423E possibly damaging Het
Cfap54 T A 10: 92,972,694 N1373I possibly damaging Het
Chrdl2 T C 7: 100,006,541 probably benign Het
Cic T G 7: 25,282,883 S12A possibly damaging Het
Csmd2 A T 4: 128,442,892 Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 H120R possibly damaging Het
Dicer1 T A 12: 104,692,446 D1779V probably damaging Het
Dock9 G T 14: 121,610,097 H1016N possibly damaging Het
Eif2b5 T A 16: 20,500,233 F78I probably damaging Het
Eri2 A G 7: 119,784,946 probably benign Het
Fam208b A G 13: 3,570,391 F2170S probably damaging Het
Fbxw7 T G 3: 84,925,689 L13V possibly damaging Het
Fgf7 T A 2: 126,035,783 C23* probably null Het
Fubp1 T A 3: 152,222,068 probably null Het
Gm2663 A T 6: 40,995,953 I240N probably damaging Het
Gnb1l C T 16: 18,548,096 Q140* probably null Het
Gnptab G A 10: 88,436,528 R1010Q probably damaging Het
Gtf2h1 G A 7: 46,822,878 W544* probably null Het
Gucy2c C T 6: 136,722,514 E586K probably damaging Het
Hc T A 2: 35,039,734 E232V probably benign Het
Ifi207 T A 1: 173,730,056 D372V unknown Het
Igkv8-28 A T 6: 70,144,118 V15E probably benign Het
Il1rap A G 16: 26,692,799 S198G possibly damaging Het
Lct A G 1: 128,300,387 I1123T probably damaging Het
Lhcgr T C 17: 88,742,697 E467G probably damaging Het
Macf1 C T 4: 123,476,015 R86K probably benign Het
Maml3 T A 3: 51,856,532 Q337L probably benign Het
March10 T A 11: 105,390,037 D474V probably benign Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mast1 A G 8: 84,937,193 probably null Het
Med12l T C 3: 59,233,212 I868T probably damaging Het
Msrb1 T C 17: 24,740,173 S100P probably damaging Het
Nlrp4c T C 7: 6,066,126 L342P probably benign Het
Nrxn3 T A 12: 90,331,956 V417E possibly damaging Het
Ntng1 T A 3: 109,934,713 D248V probably damaging Het
Oaz3 T C 3: 94,434,998 Q117R probably benign Het
Olfr1311 A G 2: 112,020,931 Y308H probably benign Het
Olfr444 A G 6: 42,955,521 I8V probably benign Het
Olfr589 A G 7: 103,155,414 L111P probably benign Het
Osbpl3 A C 6: 50,300,973 S767A probably benign Het
Pafah1b1 A T 11: 74,685,871 probably benign Het
Pard6b A G 2: 168,098,788 T232A probably damaging Het
Paxip1 A T 5: 27,765,206 C596S probably damaging Het
Pnpla6 T C 8: 3,523,818 V422A probably benign Het
Psmd6 A T 14: 14,120,932 probably benign Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sel1l T A 12: 91,813,893 H658L probably damaging Het
Sh3yl1 T A 12: 30,940,314 L105Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sirt1 T C 10: 63,335,722 K227E probably benign Het
Slc25a34 A T 4: 141,623,588 F37I possibly damaging Het
Slc39a5 T A 10: 128,397,049 I378F probably damaging Het
Smarcad1 A T 6: 65,098,824 D731V probably null Het
Sox6 T G 7: 115,541,670 K483N probably damaging Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srgap1 G T 10: 121,792,351 D882E probably benign Het
Syne4 T C 7: 30,316,833 probably benign Het
Tec T C 5: 72,768,776 Y289C probably benign Het
Tmem102 A T 11: 69,804,802 Y115N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav17 T A 14: 53,806,640 M1K probably null Het
Trdn T A 10: 33,399,082 probably null Het
Trp53 A T 11: 69,586,921 I8F probably benign Het
Ttn T A 2: 76,754,662 D22064V probably damaging Het
Ube3c G A 5: 29,632,838 probably null Het
Ulk1 C T 5: 110,788,947 probably null Het
Upp1 T C 11: 9,135,976 V271A probably damaging Het
Vmn2r4 T C 3: 64,388,661 E901G probably damaging Het
Vmn2r96 G A 17: 18,597,508 G449D probably damaging Het
Vps37b T C 5: 124,006,612 K165E probably damaging Het
Vwf A T 6: 125,566,305 I185F possibly damaging Het
Wasf2 A G 4: 133,185,004 T56A probably benign Het
Zdhhc23 C G 16: 43,973,589 D241H possibly damaging Het
Zfp276 T C 8: 123,254,884 S57P probably benign Het
Zxdc A G 6: 90,370,518 H287R probably damaging Het
Other mutations in Dxo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Dxo APN 17 34839040 missense probably damaging 1.00
R0030:Dxo UTSW 17 34837938 missense probably damaging 1.00
R1573:Dxo UTSW 17 34838294 missense probably damaging 1.00
R2182:Dxo UTSW 17 34838892 missense probably benign 0.22
R2294:Dxo UTSW 17 34838986 critical splice acceptor site probably null
R2512:Dxo UTSW 17 34837742 missense probably benign 0.01
R3410:Dxo UTSW 17 34838849 missense probably damaging 1.00
R3703:Dxo UTSW 17 34838769 intron probably benign
R6319:Dxo UTSW 17 34838391 missense probably damaging 1.00
R7570:Dxo UTSW 17 34837640 missense probably benign
R8443:Dxo UTSW 17 34839123 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACCGAGAAGGCTGGAATC -3'
(R):5'- AGGTGACTCCATTCAGACACAG -3'

Sequencing Primer
(F):5'- GGAATCCCTCTGTGTGCATGAAC -3'
(R):5'- AGAAACACGCCTTTATTATCTGCACG -3'
Posted On2015-12-29