Mutagenetix > Incidental Mutation

Incidental Mutation 'R4776:Lhcgr'

367978

Institutional Source

Beutler Lab

Gene Symbol

Lhcgr

Ensembl Gene

ENSMUSG00000024107

Gene Name

luteinizing hormone/choriogonadotropin receptor

Synonyms

Lhr, LH-R, Gpcr19-rs1

MMRRC Submission

042413-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4776 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88741549-88791976 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88742697 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 467 (E467G)

Ref Sequence

ENSEMBL: ENSMUSP00000024916 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024916]

AlphaFold

P30730

Predicted Effect

probably damaging
Transcript: ENSMUST00000024916
AA Change: E467G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000024916
Gene: ENSMUSG00000024107
AA Change: E467G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
LRRNT	33	66	4.4e0	SMART
Pfam:LRR_5	155	273	2.9e-5	PFAM
Pfam:7tm_1	380	627	1.2e-29	PFAM

Meta Mutation Damage Score

0.8356

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

98% (94/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for both luteinizing hormone and choriogonadotropin. This receptor belongs to the G-protein coupled receptor 1 family, and its activity is mediated by G proteins which activate adenylate cyclase. Mutations in this gene result in disorders of male secondary sexual character development, including familial male precocious puberty, also known as testotoxicosis, hypogonadotropic hypogonadism, Leydig cell adenoma with precocious puberty, and male pseudohermaphtoditism with Leydig cell hypoplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are infertile and have abnormal hormone levels. Males have undescended testes, immature external and accessory sex organs and blocked spermatogenesis. Females have small ovaries and uteri, immature follicles and do not cycle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,719,535	Y683*	probably null	Het
2610028H24Rik	A	T	10: 76,457,512	M156L	probably benign	Het
4930470P17Rik	C	T	2: 170,579,724	A79T	unknown	Het
4930522L14Rik	A	G	5: 109,736,873	I373T	probably benign	Het
A830010M20Rik	C	A	5: 107,510,451	A1117E	probably damaging	Het
Amotl1	G	A	9: 14,593,373	Q217*	probably null	Het
Ankrd28	A	T	14: 31,732,054	C254S	probably damaging	Het
Ap2a1	A	G	7: 44,901,546		probably benign	Het
Arfgef3	A	T	10: 18,654,247	S245T	probably benign	Het
Arntl	A	T	7: 113,285,037	K94I	probably damaging	Het
Atp1b2	A	T	11: 69,601,561	D224E	probably damaging	Het
Boc	G	A	16: 44,487,721	R924W	probably damaging	Het
Car14	C	T	3: 95,898,873	G292D	probably benign	Het
Cenpb	T	C	2: 131,178,183		probably benign	Het
Ces1b	A	T	8: 93,063,030	D423E	possibly damaging	Het
Cfap54	T	A	10: 92,972,694	N1373I	possibly damaging	Het
Chrdl2	T	C	7: 100,006,541		probably benign	Het
Cic	T	G	7: 25,282,883	S12A	possibly damaging	Het
Csmd2	A	T	4: 128,442,892	Q1421L	probably benign	Het
D630039A03Rik	T	C	4: 57,910,452	H120R	possibly damaging	Het
Dicer1	T	A	12: 104,692,446	D1779V	probably damaging	Het
Dock9	G	T	14: 121,610,097	H1016N	possibly damaging	Het
Dxo	T	C	17: 34,838,998	L352P	probably damaging	Het
Eif2b5	T	A	16: 20,500,233	F78I	probably damaging	Het
Eri2	A	G	7: 119,784,946		probably benign	Het
Fam208b	A	G	13: 3,570,391	F2170S	probably damaging	Het
Fbxw7	T	G	3: 84,925,689	L13V	possibly damaging	Het
Fgf7	T	A	2: 126,035,783	C23*	probably null	Het
Fubp1	T	A	3: 152,222,068		probably null	Het
Gm2663	A	T	6: 40,995,953	I240N	probably damaging	Het
Gnb1l	C	T	16: 18,548,096	Q140*	probably null	Het
Gnptab	G	A	10: 88,436,528	R1010Q	probably damaging	Het
Gtf2h1	G	A	7: 46,822,878	W544*	probably null	Het
Gucy2c	C	T	6: 136,722,514	E586K	probably damaging	Het
Hc	T	A	2: 35,039,734	E232V	probably benign	Het
Ifi207	T	A	1: 173,730,056	D372V	unknown	Het
Igkv8-28	A	T	6: 70,144,118	V15E	probably benign	Het
Il1rap	A	G	16: 26,692,799	S198G	possibly damaging	Het
Lct	A	G	1: 128,300,387	I1123T	probably damaging	Het
Macf1	C	T	4: 123,476,015	R86K	probably benign	Het
Maml3	T	A	3: 51,856,532	Q337L	probably benign	Het
March10	T	A	11: 105,390,037	D474V	probably benign	Het
March2	G	T	17: 33,709,916	T2K	probably damaging	Het
Mast1	A	G	8: 84,937,193		probably null	Het
Med12l	T	C	3: 59,233,212	I868T	probably damaging	Het
Msrb1	T	C	17: 24,740,173	S100P	probably damaging	Het
Nlrp4c	T	C	7: 6,066,126	L342P	probably benign	Het
Nrxn3	T	A	12: 90,331,956	V417E	possibly damaging	Het
Ntng1	T	A	3: 109,934,713	D248V	probably damaging	Het
Oaz3	T	C	3: 94,434,998	Q117R	probably benign	Het
Olfr1311	A	G	2: 112,020,931	Y308H	probably benign	Het
Olfr444	A	G	6: 42,955,521	I8V	probably benign	Het
Olfr589	A	G	7: 103,155,414	L111P	probably benign	Het
Osbpl3	A	C	6: 50,300,973	S767A	probably benign	Het
Pafah1b1	A	T	11: 74,685,871		probably benign	Het
Pard6b	A	G	2: 168,098,788	T232A	probably damaging	Het
Paxip1	A	T	5: 27,765,206	C596S	probably damaging	Het
Pnpla6	T	C	8: 3,523,818	V422A	probably benign	Het
Psmd6	A	T	14: 14,120,932		probably benign	Het
Rock2	T	A	12: 16,977,740	C1353S	probably damaging	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Sel1l	T	A	12: 91,813,893	H658L	probably damaging	Het
Sh3yl1	T	A	12: 30,940,314	L105Q	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sirt1	T	C	10: 63,335,722	K227E	probably benign	Het
Slc25a34	A	T	4: 141,623,588	F37I	possibly damaging	Het
Slc39a5	T	A	10: 128,397,049	I378F	probably damaging	Het
Smarcad1	A	T	6: 65,098,824	D731V	probably null	Het
Sox6	T	G	7: 115,541,670	K483N	probably damaging	Het
Sp140	T	A	1: 85,610,828	D95E	possibly damaging	Het
Srgap1	G	T	10: 121,792,351	D882E	probably benign	Het
Syne4	T	C	7: 30,316,833		probably benign	Het
Tec	T	C	5: 72,768,776	Y289C	probably benign	Het
Tmem102	A	T	11: 69,804,802	Y115N	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trav17	T	A	14: 53,806,640	M1K	probably null	Het
Trdn	T	A	10: 33,399,082		probably null	Het
Trp53	A	T	11: 69,586,921	I8F	probably benign	Het
Ttn	T	A	2: 76,754,662	D22064V	probably damaging	Het
Ube3c	G	A	5: 29,632,838		probably null	Het
Ulk1	C	T	5: 110,788,947		probably null	Het
Upp1	T	C	11: 9,135,976	V271A	probably damaging	Het
Vmn2r4	T	C	3: 64,388,661	E901G	probably damaging	Het
Vmn2r96	G	A	17: 18,597,508	G449D	probably damaging	Het
Vps37b	T	C	5: 124,006,612	K165E	probably damaging	Het
Vwf	A	T	6: 125,566,305	I185F	possibly damaging	Het
Wasf2	A	G	4: 133,185,004	T56A	probably benign	Het
Zdhhc23	C	G	16: 43,973,589	D241H	possibly damaging	Het
Zfp276	T	C	8: 123,254,884	S57P	probably benign	Het
Zxdc	A	G	6: 90,370,518	H287R	probably damaging	Het

Other mutations in Lhcgr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Lhcgr	APN	17	88742446	missense	probably benign
IGL00661:Lhcgr	APN	17	88750118	missense	probably benign
IGL00840:Lhcgr	APN	17	88753736	splice site	probably benign
IGL01434:Lhcgr	APN	17	88742437	missense	probably damaging	1.00
IGL01489:Lhcgr	APN	17	88764973	splice site	probably benign
IGL02077:Lhcgr	APN	17	88750130	missense	probably benign	0.06
IGL02533:Lhcgr	APN	17	88742410	missense	probably benign	0.00
IGL02948:Lhcgr	APN	17	88742622	missense	probably damaging	1.00
capybara	UTSW	17	88742586	nonsense	probably null
coro	UTSW	17	88742249	nonsense	probably null
nutria	UTSW	17	88742373	missense	probably damaging	1.00
R0101:Lhcgr	UTSW	17	88765170	missense	probably damaging	1.00
R0101:Lhcgr	UTSW	17	88765170	missense	probably damaging	1.00
R0556:Lhcgr	UTSW	17	88772063	missense	probably damaging	0.99
R1824:Lhcgr	UTSW	17	88750157	missense	probably benign	0.00
R1846:Lhcgr	UTSW	17	88765147	critical splice donor site	probably null
R1852:Lhcgr	UTSW	17	88765176	missense	probably damaging	0.99
R2352:Lhcgr	UTSW	17	88742299	missense	possibly damaging	0.52
R3147:Lhcgr	UTSW	17	88758343	missense	probably damaging	0.96
R3756:Lhcgr	UTSW	17	88753856	missense	possibly damaging	0.77
R4180:Lhcgr	UTSW	17	88742283	missense	probably damaging	1.00
R4540:Lhcgr	UTSW	17	88755608	missense	probably benign
R4688:Lhcgr	UTSW	17	88765152	missense	probably damaging	0.99
R4717:Lhcgr	UTSW	17	88742467	missense	probably benign	0.00
R4723:Lhcgr	UTSW	17	88742602	missense	probably benign	0.09
R4903:Lhcgr	UTSW	17	88742361	missense	probably damaging	1.00
R5195:Lhcgr	UTSW	17	88742946	missense	probably damaging	1.00
R5231:Lhcgr	UTSW	17	88755611	missense	probably damaging	1.00
R5361:Lhcgr	UTSW	17	88742853	missense	probably damaging	1.00
R5683:Lhcgr	UTSW	17	88772019	missense	probably benign	0.00
R5758:Lhcgr	UTSW	17	88742548	missense	probably damaging	0.99
R5929:Lhcgr	UTSW	17	88743008	nonsense	probably null
R5987:Lhcgr	UTSW	17	88755578	missense	probably damaging	1.00
R6268:Lhcgr	UTSW	17	88742704	missense	probably damaging	1.00
R6477:Lhcgr	UTSW	17	88742373	missense	probably damaging	1.00
R6610:Lhcgr	UTSW	17	88769879	missense	possibly damaging	0.93
R7234:Lhcgr	UTSW	17	88791931	missense	possibly damaging	0.96
R7282:Lhcgr	UTSW	17	88758383	missense	probably benign
R7320:Lhcgr	UTSW	17	88742078	missense	probably benign
R7398:Lhcgr	UTSW	17	88772046	missense	probably benign	0.03
R7710:Lhcgr	UTSW	17	88742782	missense	probably damaging	1.00
R8034:Lhcgr	UTSW	17	88742356	missense	probably damaging	1.00
R8108:Lhcgr	UTSW	17	88742050	nonsense	probably null
R8150:Lhcgr	UTSW	17	88742249	nonsense	probably null
R8151:Lhcgr	UTSW	17	88742249	nonsense	probably null
R8236:Lhcgr	UTSW	17	88742586	nonsense	probably null
R8901:Lhcgr	UTSW	17	88755602	missense	probably damaging	1.00
R8916:Lhcgr	UTSW	17	88753742	critical splice donor site	probably null
R9632:Lhcgr	UTSW	17	88742104	missense	probably benign
R9716:Lhcgr	UTSW	17	88743018	missense	probably damaging	1.00
U24488:Lhcgr	UTSW	17	88772085	critical splice acceptor site	probably null
X0028:Lhcgr	UTSW	17	88742722	missense	probably damaging	1.00
Z1176:Lhcgr	UTSW	17	88742270	missense	probably damaging	1.00
Z1177:Lhcgr	UTSW	17	88753905	missense	probably benign	0.00
Z1177:Lhcgr	UTSW	17	88764981	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CACTGCATTGAGGAGCAAGATG -3'
(R):5'- AGACTTTTGCATGGGGCTC -3'

Sequencing Primer
(F):5'- AGACTTGTGACAGAGTGGATTCC -3'
(R):5'- TTGCATGGGGCTCTACCTGC -3'

Posted On

2015-12-29