Mutagenetix > Incidental Mutations

Incidental Mutation 'R4777:Il16'

368019

Institutional Source

Beutler Lab

Gene Symbol

Il16

Ensembl Gene

ENSMUSG00000001741

Gene Name

interleukin 16

Synonyms

MMRRC Submission

041992-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.234) question?

Stock #

R4777 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83642825-83745726 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 83650896 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 396 (D396E)

Ref Sequence

ENSEMBL: ENSMUSP00000146496 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001792] [ENSMUST00000117410] [ENSMUST00000145610]

Predicted Effect

probably benign
Transcript: ENSMUST00000001792
AA Change: D1094E

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000001792
Gene: ENSMUSG00000001741
AA Change: D1094E

Domain	Start	End	E-Value	Type
low complexity region	76	92	N/A	INTRINSIC
low complexity region	99	115	N/A	INTRINSIC
PDZ	222	300	6.5e-23	SMART
PDZ	361	438	3.89e-12	SMART
low complexity region	507	526	N/A	INTRINSIC
low complexity region	556	577	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	647	680	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC
low complexity region	825	839	N/A	INTRINSIC
low complexity region	978	989	N/A	INTRINSIC
PDZ	1115	1192	3.6e-16	SMART
low complexity region	1201	1216	N/A	INTRINSIC
PDZ	1234	1310	4.11e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117410

SMART Domains

Protein: ENSMUSP00000112781
Gene: ENSMUSG00000046027

Domain	Start	End	E-Value	Type
Pfam:START	7	196	5.9e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000145610
AA Change: D396E

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151047

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a transient but consistent increase of thymidine incorporation in anti-CD3-stimulated CD4+ T cells, but fail to show a hyperproliferative T cell phenotype using BrdU labeling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	C	3: 138,065,742	S231R	probably benign	Het
2010109I03Rik	T	C	15: 74,880,683	N48S	probably benign	Het
5730455P16Rik	A	T	11: 80,374,215	I137N	probably damaging	Het
Abhd10	G	A	16: 45,736,916	Q176*	probably null	Het
Acer3	T	C	7: 98,261,597	Y86C	probably damaging	Het
Ankrd36	T	C	11: 5,607,120	V356A	probably benign	Het
Atp1a1	A	G	3: 101,594,996		probably null	Het
Bmp8b	G	A	4: 123,122,000	R260Q	possibly damaging	Het
C2cd3	T	A	7: 100,416,332	V775D	possibly damaging	Het
Cacna1b	T	A	2: 24,732,325	I216F	probably damaging	Het
Capn5	T	A	7: 98,131,718	N284I	probably damaging	Het
Cbr1	C	A	16: 93,610,054	D219E	probably benign	Het
Ccdc109b	T	A	3: 129,969,951	Q42L	probably damaging	Het
Cdca2	C	T	14: 67,713,140	R114Q	probably damaging	Het
Cdh7	G	A	1: 109,994,325	W49*	probably null	Het
Cep152	C	T	2: 125,564,095	V1506I	probably benign	Het
Cfap97	C	T	8: 46,195,297	Q537*	probably null	Het
Cpsf2	T	A	12: 101,996,832	V385E	probably damaging	Het
Dse	A	G	10: 34,153,588	V502A	possibly damaging	Het
Fam171a1	T	A	2: 3,223,513	F300L	probably benign	Het
Fnip1	T	G	11: 54,500,556	N438K	probably damaging	Het
Fstl5	C	T	3: 76,593,500	T412M	probably damaging	Het
Gm11938	T	A	11: 99,603,233	Q12L	unknown	Het
Hcls1	G	T	16: 36,955,316	A171S	probably damaging	Het
Hcn1	ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	13: 117,975,733		probably benign	Het
Hydin	G	T	8: 110,410,464	C633F	probably damaging	Het
Ica1	A	T	6: 8,644,145	D381E	probably benign	Het
Ift74	A	G	4: 94,652,997	K220E	probably benign	Het
Igfn1	A	T	1: 135,954,862	D2748E	probably benign	Het
Impdh1	G	T	6: 29,205,202	A200E	possibly damaging	Het
Itga4	C	T	2: 79,313,710	T647I	possibly damaging	Het
Jpt1	A	T	11: 115,500,671	M104K	probably benign	Het
Krt73	C	A	15: 101,794,001	A476S	probably benign	Het
Lama3	T	C	18: 12,413,771	Y363H	probably damaging	Het
Lgr4	C	T	2: 109,996,682	P177L	probably damaging	Het
Lrp2	T	C	2: 69,482,264	D2560G	probably damaging	Het
Macf1	A	T	4: 123,376,502	F6617I	probably damaging	Het
Mcf2l	T	A	8: 13,018,051		probably null	Het
Mfsd9	C	T	1: 40,781,540	V150I	possibly damaging	Het
Myo15b	T	C	11: 115,879,652	V96A	probably damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Olfr398	A	G	11: 73,984,395	V71A	probably benign	Het
Olfr432	T	G	1: 174,050,678	Y102D	probably damaging	Het
Olfr981	T	C	9: 40,022,698	F102L	possibly damaging	Het
Pinlyp	T	A	7: 24,542,143	I153F	possibly damaging	Het
Plk2	A	C	13: 110,397,773	M296L	probably benign	Het
Plvap	T	C	8: 71,507,986	Y262C	probably benign	Het
Ppfia3	C	A	7: 45,341,157	G1066V	probably damaging	Het
Prokr1	A	G	6: 87,588,860	M1T	probably null	Het
Ptgs2	G	T	1: 150,105,387	A474S	probably benign	Het
Pth2r	A	G	1: 65,388,517	T450A	possibly damaging	Het
Ranbp6	A	T	19: 29,811,637	F438L	probably damaging	Het
Ripor1	A	T	8: 105,614,990	Q102L	probably damaging	Het
Rprd2	C	T	3: 95,787,374	V116I	probably benign	Het
Sacs	T	C	14: 61,211,809	V3768A	probably damaging	Het
Scn8a	T	C	15: 101,015,951	Y1075H	probably damaging	Het
Senp3	C	T	11: 69,678,237	G366D	probably damaging	Het
Smim1	T	C	4: 154,023,650		probably benign	Het
Sptan1	A	G	2: 29,996,435	I817V	probably damaging	Het
Stag3	A	T	5: 138,309,199		probably benign	Het
Stk17b	A	T	1: 53,771,708	H79Q	probably damaging	Het
Svil	A	G	18: 5,088,813	K1296E	probably damaging	Het
Tmem117	T	A	15: 95,094,450	Y330*	probably null	Het
Tmem8	T	C	17: 26,121,541	V633A	probably damaging	Het
Tnxb	G	T	17: 34,671,943	R420L	probably damaging	Het
Trim9	C	A	12: 70,347,071	C33F	probably damaging	Het
Usp29	A	C	7: 6,962,748	Y530S	probably benign	Het
Vps26b	T	C	9: 27,010,456	T258A	possibly damaging	Het
Vrtn	C	A	12: 84,648,826	H117N	probably damaging	Het
Wdr33	C	T	18: 31,881,248	H388Y	probably damaging	Het
Zfp451	A	T	1: 33,782,105	V222D	possibly damaging	Het
Zfp953	A	G	13: 67,343,129	I253T	probably benign	Het
Zfy2	A	G	Y: 2,116,194	V282A	probably benign	Het
Zscan29	A	T	2: 121,169,324	V132D	probably damaging	Het
Zswim4	G	T	8: 84,236,957	D16E	probably benign	Het

Other mutations in Il16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Il16	APN	7	83652458	missense	probably benign	0.02
IGL01743:Il16	APN	7	83652299	missense	probably benign	0.00
IGL01770:Il16	APN	7	83673026	splice site	probably benign
IGL02025:Il16	APN	7	83652848	missense	probably damaging	1.00
IGL02317:Il16	APN	7	83666889	missense	probably damaging	1.00
IGL02412:Il16	APN	7	83652691	missense	probably benign	0.03
IGL02550:Il16	APN	7	83674496	missense	possibly damaging	0.90
IGL02568:Il16	APN	7	83661276	missense	probably damaging	1.00
IGL02578:Il16	APN	7	83677986	critical splice donor site	probably null
IGL02815:Il16	APN	7	83651041	missense	probably damaging	0.98
IGL03157:Il16	APN	7	83722403	missense	probably damaging	1.00
IGL03161:Il16	APN	7	83722499	missense	probably damaging	1.00
IGL03188:Il16	APN	7	83688163	missense	probably benign	0.00
IGL03213:Il16	APN	7	83646500	missense	probably damaging	1.00
IGL03274:Il16	APN	7	83661234	missense	probably damaging	1.00
R0201:Il16	UTSW	7	83722308	missense	probably damaging	0.99
R0309:Il16	UTSW	7	83722554	missense	probably damaging	1.00
R0597:Il16	UTSW	7	83677975	splice site	probably benign
R0942:Il16	UTSW	7	83663141	missense	probably benign	0.01
R1018:Il16	UTSW	7	83674538	missense	probably damaging	1.00
R1434:Il16	UTSW	7	83655312	missense	probably benign
R1715:Il16	UTSW	7	83648728	missense	probably benign	0.01
R2179:Il16	UTSW	7	83688079	splice site	probably null
R2520:Il16	UTSW	7	83651994	missense	probably benign	0.03
R3425:Il16	UTSW	7	83644040	missense	probably damaging	1.00
R3761:Il16	UTSW	7	83650885	missense	possibly damaging	0.96
R3943:Il16	UTSW	7	83652015	missense	probably damaging	0.97
R4470:Il16	UTSW	7	83650838	intron	probably benign
R4530:Il16	UTSW	7	83681310	intron	probably benign
R4583:Il16	UTSW	7	83682899	missense	probably damaging	1.00
R4874:Il16	UTSW	7	83660945	missense	possibly damaging	0.56
R4876:Il16	UTSW	7	83673094	missense	probably benign
R5677:Il16	UTSW	7	83674553	missense	probably damaging	1.00
R5686:Il16	UTSW	7	83648728	missense	probably benign	0.36
R5920:Il16	UTSW	7	83652344	missense	probably benign	0.03
R6115:Il16	UTSW	7	83652567	nonsense	probably null
R6459:Il16	UTSW	7	83722321	missense	probably damaging	1.00
R6459:Il16	UTSW	7	83722328	missense	probably damaging	1.00
R6601:Il16	UTSW	7	83722469	missense	probably damaging	1.00
R6616:Il16	UTSW	7	83646476	missense	probably benign	0.37
R6642:Il16	UTSW	7	83688127	missense	probably benign	0.03
R6721:Il16	UTSW	7	83663062	critical splice donor site	probably null
R7009:Il16	UTSW	7	83646388	missense	probably benign
R7144:Il16	UTSW	7	83646451	missense	probably damaging	0.97
R7346:Il16	UTSW	7	83644041	missense	probably damaging	1.00
R7403:Il16	UTSW	7	83670135	missense	probably damaging	1.00
R7499:Il16	UTSW	7	83674494	missense	probably damaging	0.99
R7814:Il16	UTSW	7	83670140	missense	possibly damaging	0.46
R7941:Il16	UTSW	7	83682829	missense	probably damaging	0.98
R8098:Il16	UTSW	7	83646559	missense	probably damaging	1.00
R8317:Il16	UTSW	7	83655330	missense	probably benign
R8437:Il16	UTSW	7	83652143	missense	probably damaging	1.00
Z1176:Il16	UTSW	7	83652827	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TCCCAGCTAAAATCAGGTGTTAAC -3'
(R):5'- GTTATCTCTGCTTGTGAAAGCC -3'

Sequencing Primer
(F):5'- AAGTGACATGGTGTCCCTCTAC -3'
(R):5'- GCCTTTCAGAGCTGAGAGAATATTC -3'

Posted On

2015-12-29