Incidental Mutation 'R4777:Nfkb2'
ID368066
Institutional Source Beutler Lab
Gene Symbol Nfkb2
Ensembl Gene ENSMUSG00000025225
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
SynonymsNF kappaB2, p52
MMRRC Submission 041992-MU
Accession Numbers

Genbank: NM_019408; MGI: 1099800

Is this an essential gene? Possibly essential (E-score: 0.727) question?
Stock #R4777 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location46304737-46312090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46307567 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 170 (E170D)
Ref Sequence ENSEMBL: ENSMUSP00000107512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041391] [ENSMUST00000073116] [ENSMUST00000096029] [ENSMUST00000111881] [ENSMUST00000224556] [ENSMUST00000225323]
Predicted Effect probably benign
Transcript: ENSMUST00000041391
SMART Domains Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 519 708 5.08e-75 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 736 744 N/A INTRINSIC
PH 757 871 1.87e-13 SMART
Blast:Sec7 900 952 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000073116
AA Change: E170D

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000072859
Gene: ENSMUSG00000025225
AA Change: E170D

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096029
SMART Domains Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 520 709 5.08e-75 SMART
low complexity region 715 725 N/A INTRINSIC
low complexity region 737 745 N/A INTRINSIC
PH 758 872 1.87e-13 SMART
Blast:Sec7 901 953 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111881
AA Change: E170D

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107512
Gene: ENSMUSG00000025225
AA Change: E170D

DomainStartEndE-ValueType
Pfam:RHD 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224556
Predicted Effect probably benign
Transcript: ENSMUST00000225323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225748
Meta Mutation Damage Score 0.0839 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the transcription factor complex nuclear factor-kappa-B (NFkB). The NFkB complex is expressed in numerous cell types and functions as a central activator of genes involved in inflammation and immune function. The protein encoded by this gene can function as both a transcriptional activator or repressor depending on its dimerization partner. The p100 full-length protein is co-translationally processed into a p52 active form. Chromosomal rearrangements and translocations of this locus have been observed in B cell lymphomas, some of which may result in the formation of fusion proteins. There is a pseudogene for this gene on chromosome 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit gastric hyperplasia, enlarged lymph nodes, enhanced cytokine production by activated T cells, absence of Peyer's patches, increased susceptibility to Leishmania major, and early postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(5) Chemically induced(2)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,065,742 S231R probably benign Het
2010109I03Rik T C 15: 74,880,683 N48S probably benign Het
5730455P16Rik A T 11: 80,374,215 I137N probably damaging Het
Abhd10 G A 16: 45,736,916 Q176* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Ankrd36 T C 11: 5,607,120 V356A probably benign Het
Atp1a1 A G 3: 101,594,996 probably null Het
Bmp8b G A 4: 123,122,000 R260Q possibly damaging Het
C2cd3 T A 7: 100,416,332 V775D possibly damaging Het
Cacna1b T A 2: 24,732,325 I216F probably damaging Het
Capn5 T A 7: 98,131,718 N284I probably damaging Het
Cbr1 C A 16: 93,610,054 D219E probably benign Het
Ccdc109b T A 3: 129,969,951 Q42L probably damaging Het
Cdca2 C T 14: 67,713,140 R114Q probably damaging Het
Cdh7 G A 1: 109,994,325 W49* probably null Het
Cep152 C T 2: 125,564,095 V1506I probably benign Het
Cfap97 C T 8: 46,195,297 Q537* probably null Het
Cpsf2 T A 12: 101,996,832 V385E probably damaging Het
Dse A G 10: 34,153,588 V502A possibly damaging Het
Fam171a1 T A 2: 3,223,513 F300L probably benign Het
Fnip1 T G 11: 54,500,556 N438K probably damaging Het
Fstl5 C T 3: 76,593,500 T412M probably damaging Het
Gm11938 T A 11: 99,603,233 Q12L unknown Het
Hcls1 G T 16: 36,955,316 A171S probably damaging Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,733 probably benign Het
Hydin G T 8: 110,410,464 C633F probably damaging Het
Ica1 A T 6: 8,644,145 D381E probably benign Het
Ift74 A G 4: 94,652,997 K220E probably benign Het
Igfn1 A T 1: 135,954,862 D2748E probably benign Het
Il16 A C 7: 83,650,896 D396E probably benign Het
Impdh1 G T 6: 29,205,202 A200E possibly damaging Het
Itga4 C T 2: 79,313,710 T647I possibly damaging Het
Jpt1 A T 11: 115,500,671 M104K probably benign Het
Krt73 C A 15: 101,794,001 A476S probably benign Het
Lama3 T C 18: 12,413,771 Y363H probably damaging Het
Lgr4 C T 2: 109,996,682 P177L probably damaging Het
Lrp2 T C 2: 69,482,264 D2560G probably damaging Het
Macf1 A T 4: 123,376,502 F6617I probably damaging Het
Mcf2l T A 8: 13,018,051 probably null Het
Mfsd9 C T 1: 40,781,540 V150I possibly damaging Het
Myo15b T C 11: 115,879,652 V96A probably damaging Het
Olfr398 A G 11: 73,984,395 V71A probably benign Het
Olfr432 T G 1: 174,050,678 Y102D probably damaging Het
Olfr981 T C 9: 40,022,698 F102L possibly damaging Het
Pinlyp T A 7: 24,542,143 I153F possibly damaging Het
Plk2 A C 13: 110,397,773 M296L probably benign Het
Plvap T C 8: 71,507,986 Y262C probably benign Het
Ppfia3 C A 7: 45,341,157 G1066V probably damaging Het
Prokr1 A G 6: 87,588,860 M1T probably null Het
Ptgs2 G T 1: 150,105,387 A474S probably benign Het
Pth2r A G 1: 65,388,517 T450A possibly damaging Het
Ranbp6 A T 19: 29,811,637 F438L probably damaging Het
Ripor1 A T 8: 105,614,990 Q102L probably damaging Het
Rprd2 C T 3: 95,787,374 V116I probably benign Het
Sacs T C 14: 61,211,809 V3768A probably damaging Het
Scn8a T C 15: 101,015,951 Y1075H probably damaging Het
Senp3 C T 11: 69,678,237 G366D probably damaging Het
Smim1 T C 4: 154,023,650 probably benign Het
Sptan1 A G 2: 29,996,435 I817V probably damaging Het
Stag3 A T 5: 138,309,199 probably benign Het
Stk17b A T 1: 53,771,708 H79Q probably damaging Het
Svil A G 18: 5,088,813 K1296E probably damaging Het
Tmem117 T A 15: 95,094,450 Y330* probably null Het
Tmem8 T C 17: 26,121,541 V633A probably damaging Het
Tnxb G T 17: 34,671,943 R420L probably damaging Het
Trim9 C A 12: 70,347,071 C33F probably damaging Het
Usp29 A C 7: 6,962,748 Y530S probably benign Het
Vps26b T C 9: 27,010,456 T258A possibly damaging Het
Vrtn C A 12: 84,648,826 H117N probably damaging Het
Wdr33 C T 18: 31,881,248 H388Y probably damaging Het
Zfp451 A T 1: 33,782,105 V222D possibly damaging Het
Zfp953 A G 13: 67,343,129 I253T probably benign Het
Zfy2 A G Y: 2,116,194 V282A probably benign Het
Zscan29 A T 2: 121,169,324 V132D probably damaging Het
Zswim4 G T 8: 84,236,957 D16E probably benign Het
Other mutations in Nfkb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
xander APN 19 splice acceptor site
IGL01466:Nfkb2 APN 19 46308016 missense probably damaging 0.96
IGL01791:Nfkb2 APN 19 46309839 unclassified probably benign
IGL01966:Nfkb2 APN 19 46309690 missense probably benign 0.04
IGL03296:Nfkb2 APN 19 46309928 missense probably damaging 1.00
Dolores UTSW 19 46308223 missense possibly damaging 0.86
humbert UTSW 19 46307441 missense possibly damaging 0.86
lolita UTSW 19 46307720 critical splice donor site probably null
Nabukov UTSW 19 46308439 missense probably damaging 0.99
pale_fire UTSW 19 46311626 missense possibly damaging 0.96
Quilty UTSW 19 46308643 missense possibly damaging 0.64
R0270:Nfkb2 UTSW 19 46311626 missense possibly damaging 0.96
R0561:Nfkb2 UTSW 19 46309862 missense possibly damaging 0.93
R1944:Nfkb2 UTSW 19 46308052 missense probably damaging 1.00
R2217:Nfkb2 UTSW 19 46307724 splice site probably null
R2878:Nfkb2 UTSW 19 46307441 missense possibly damaging 0.86
R4493:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4494:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4495:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4731:Nfkb2 UTSW 19 46308964 missense possibly damaging 0.74
R4752:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4753:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4780:Nfkb2 UTSW 19 46309922 missense probably damaging 1.00
R4820:Nfkb2 UTSW 19 46308054 missense probably damaging 0.99
R4837:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4839:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5514:Nfkb2 UTSW 19 46311408 missense probably damaging 1.00
R5519:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5549:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5615:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5616:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5709:Nfkb2 UTSW 19 46310521 missense probably damaging 1.00
R6053:Nfkb2 UTSW 19 46311812 missense probably damaging 1.00
R6794:Nfkb2 UTSW 19 46307720 critical splice donor site probably null
R7539:Nfkb2 UTSW 19 46308223 missense possibly damaging 0.86
R7573:Nfkb2 UTSW 19 46308643 missense possibly damaging 0.64
R8147:Nfkb2 UTSW 19 46307434 missense possibly damaging 0.93
R8153:Nfkb2 UTSW 19 46308016 missense probably damaging 0.96
S24628:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
Z1177:Nfkb2 UTSW 19 46311590 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGTGTCCTGCATGTAAC -3'
(R):5'- GGTATCTCAAGCGCTCTTTTGG -3'

Sequencing Primer
(F):5'- TGTCCTGCATGTAACCAAGAAG -3'
(R):5'- CAAGCGCTCTTTTGGGAATGC -3'
Posted On2015-12-29