Incidental Mutation 'R4778:Stau1'
ID 368070
Institutional Source Beutler Lab
Gene Symbol Stau1
Ensembl Gene ENSMUSG00000039536
Gene Name staufen double-stranded RNA binding protein 1
Synonyms 5830401L18Rik
MMRRC Submission 042414-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4778 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 166789469-166838219 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 166805442 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 51 (N51K)
Ref Sequence ENSEMBL: ENSMUSP00000139039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049412] [ENSMUST00000109235] [ENSMUST00000109236] [ENSMUST00000109238] [ENSMUST00000184390]
AlphaFold Q9Z108
Predicted Effect probably benign
Transcript: ENSMUST00000049412
AA Change: N51K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042626
Gene: ENSMUSG00000039536
AA Change: N51K

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 199 265 5.54e-22 SMART
PDB:4DKK|A 355 469 2e-69 PDB
Blast:DSRM 401 466 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109235
AA Change: N51K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104858
Gene: ENSMUSG00000039536
AA Change: N51K

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 199 265 5.54e-22 SMART
PDB:4DKK|A 355 469 3e-69 PDB
Blast:DSRM 401 466 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109236
AA Change: N51K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104859
Gene: ENSMUSG00000039536
AA Change: N51K

DomainStartEndE-ValueType
Blast:DSRM 1 73 4e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 197 263 5.54e-22 SMART
PDB:4DKK|A 353 467 3e-69 PDB
Blast:DSRM 399 464 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109238
AA Change: N51K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104861
Gene: ENSMUSG00000039536
AA Change: N51K

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 168 4.04e-15 SMART
DSRM 205 271 5.54e-22 SMART
Pfam:Staufen_C 364 475 5.9e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154506
Predicted Effect probably benign
Transcript: ENSMUST00000184390
AA Change: N51K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000139039
Gene: ENSMUSG00000039536
AA Change: N51K

DomainStartEndE-ValueType
Blast:DSRM 1 73 4e-21 BLAST
DSRM 97 168 4.04e-15 SMART
DSRM 205 271 5.54e-22 SMART
Meta Mutation Damage Score 0.0840 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Staufen is a member of the family of double-stranded RNA (dsRNA)-binding proteins involved in the transport and/or localization of mRNAs to different subcellular compartments and/or organelles. These proteins are characterized by the presence of multiple dsRNA-binding domains which are required to bind RNAs having double-stranded secondary structures. The human homologue of staufen encoded by STAU, in addition contains a microtubule- binding domain similar to that of microtubule-associated protein 1B, and binds tubulin. The STAU gene product has been shown to be present in the cytoplasm in association with the rough endoplasmic reticulum (RER), implicating this protein in the transport of mRNA via the microtubule network to the RER, the site of translation. Five transcript variants resulting from alternative splicing of STAU gene and encoding three isoforms have been described. Three of these variants encode the same isoform, however, differ in their 5'UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit hypoactivity and impaired dendrite outgrowth and spine formation. [provided by MGI curators]
Allele List at MGI

All alleles(55) : Targeted, other(1) Gene trapped(54)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,615,342 (GRCm39) N1349S probably damaging Het
Ahnak T C 19: 8,989,339 (GRCm39) V3541A possibly damaging Het
Arhgap33 T A 7: 30,231,518 (GRCm39) T156S probably benign Het
Bltp1 T A 3: 36,991,214 (GRCm39) M897K possibly damaging Het
Card11 G T 5: 140,869,537 (GRCm39) probably null Het
Cdh3 T A 8: 107,270,458 (GRCm39) I445N probably damaging Het
Csrp3 T G 7: 48,482,311 (GRCm39) K169N probably damaging Het
Cyp2c69 T C 19: 39,866,038 (GRCm39) N185S probably benign Het
Czib T C 4: 107,749,195 (GRCm39) V64A probably damaging Het
Dpysl3 C T 18: 43,487,867 (GRCm39) V159I probably benign Het
Erc1 A T 6: 119,774,298 (GRCm39) probably null Het
Fat1 T C 8: 45,491,363 (GRCm39) V3808A probably benign Het
Fbxw19 T C 9: 109,323,714 (GRCm39) D87G probably damaging Het
Gm1123 T C 9: 98,900,560 (GRCm39) I99V probably benign Het
Gm11677 C T 11: 111,615,537 (GRCm39) noncoding transcript Het
Hand1 T C 11: 57,722,449 (GRCm39) D55G possibly damaging Het
Lrguk T A 6: 34,033,015 (GRCm39) I227K probably damaging Het
Mdn1 C T 4: 32,683,583 (GRCm39) R726* probably null Het
Minar1 T A 9: 89,485,155 (GRCm39) I81F probably damaging Het
Myo16 T A 8: 10,619,694 (GRCm39) V1415E probably damaging Het
Myof T C 19: 37,938,011 (GRCm39) D901G probably damaging Het
Naip1 A G 13: 100,563,156 (GRCm39) Y670H probably damaging Het
Nmd3 T A 3: 69,638,924 (GRCm39) Y171* probably null Het
Notch4 C T 17: 34,801,485 (GRCm39) A1111V possibly damaging Het
Nphp4 T A 4: 152,640,748 (GRCm39) D1038E probably benign Het
Or2ag1b A C 7: 106,288,874 (GRCm39) S21R probably damaging Het
Or5p60 A T 7: 107,723,687 (GRCm39) I261N possibly damaging Het
Osbpl10 C T 9: 114,938,598 (GRCm39) S86L probably damaging Het
Pcsk6 G A 7: 65,608,893 (GRCm39) G252R probably damaging Het
Pole T G 5: 110,478,698 (GRCm39) H15Q probably benign Het
Pstpip1 A G 9: 56,035,904 (GRCm39) D383G possibly damaging Het
Ptprq T C 10: 107,426,883 (GRCm39) T1551A probably benign Het
Rasgrf2 A G 13: 92,131,780 (GRCm39) F626L probably damaging Het
Retreg1 C A 15: 25,971,871 (GRCm39) N394K possibly damaging Het
Rpl7-ps8 T A 15: 59,083,252 (GRCm39) noncoding transcript Het
Rpp14 T A 14: 8,090,203 (GRCm38) D42E probably benign Het
Rrp8 T A 7: 105,386,481 (GRCm39) probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Snx1 T C 9: 66,008,698 (GRCm39) probably benign Het
Tdrd5 T A 1: 156,083,157 (GRCm39) D960V probably damaging Het
Tex10 T C 4: 48,436,468 (GRCm39) D750G probably damaging Het
Tmem43 T C 6: 91,459,237 (GRCm39) V236A probably damaging Het
Tmem89 T C 9: 108,744,443 (GRCm39) V112A probably damaging Het
Traf7 C G 17: 24,729,412 (GRCm39) probably benign Het
Vmn1r41 A C 6: 89,724,257 (GRCm39) K266T probably damaging Het
Vmn2r65 T C 7: 84,592,801 (GRCm39) K469E possibly damaging Het
Zfp831 A G 2: 174,488,600 (GRCm39) T1092A possibly damaging Het
Zfp981 T A 4: 146,622,112 (GRCm39) S346T probably benign Het
Other mutations in Stau1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Stau1 APN 2 166,792,729 (GRCm39) missense probably benign 0.03
IGL00531:Stau1 APN 2 166,806,542 (GRCm39) missense probably benign 0.00
IGL00553:Stau1 APN 2 166,793,254 (GRCm39) missense possibly damaging 0.88
IGL02311:Stau1 APN 2 166,792,239 (GRCm39) missense probably damaging 1.00
IGL02558:Stau1 APN 2 166,792,768 (GRCm39) missense probably benign 0.10
IGL02746:Stau1 APN 2 166,796,818 (GRCm39) critical splice donor site probably null
IGL02797:Stau1 APN 2 166,791,266 (GRCm39) makesense probably null
IGL03308:Stau1 APN 2 166,792,240 (GRCm39) missense probably damaging 1.00
D4216:Stau1 UTSW 2 166,791,670 (GRCm39) missense probably benign
R0614:Stau1 UTSW 2 166,792,726 (GRCm39) missense probably damaging 1.00
R1036:Stau1 UTSW 2 166,793,235 (GRCm39) missense probably damaging 0.96
R2935:Stau1 UTSW 2 166,797,037 (GRCm39) missense probably benign 0.00
R3078:Stau1 UTSW 2 166,796,936 (GRCm39) missense possibly damaging 0.68
R4542:Stau1 UTSW 2 166,795,181 (GRCm39) missense probably damaging 1.00
R6397:Stau1 UTSW 2 166,792,927 (GRCm39) missense possibly damaging 0.83
R7208:Stau1 UTSW 2 166,805,494 (GRCm39) missense probably damaging 0.98
R7870:Stau1 UTSW 2 166,792,870 (GRCm39) missense possibly damaging 0.89
R7877:Stau1 UTSW 2 166,792,787 (GRCm39) missense possibly damaging 0.95
R8844:Stau1 UTSW 2 166,793,266 (GRCm39) missense probably benign 0.00
R9174:Stau1 UTSW 2 166,791,269 (GRCm39) missense probably damaging 0.99
R9353:Stau1 UTSW 2 166,792,267 (GRCm39) missense probably damaging 1.00
R9410:Stau1 UTSW 2 166,797,038 (GRCm39) missense probably benign
R9784:Stau1 UTSW 2 166,791,695 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAAAGGCCATTTGCTTTCC -3'
(R):5'- GTGACAAGGCCAGAGTACAC -3'

Sequencing Primer
(F):5'- CTGAGACATTTAGGGGACACTTTCC -3'
(R):5'- CACAAAGAGTGGGGTTTGCTG -3'
Posted On 2015-12-29