Incidental Mutation 'R4778:Zfp831'
ID368071
Institutional Source Beutler Lab
Gene Symbol Zfp831
Ensembl Gene ENSMUSG00000050600
Gene Namezinc finger protein 831
SynonymsENSMUSG00000050600, OTTMUSG00000017459
MMRRC Submission 042414-MU
Accession Numbers

Genbank: NM_001099328; MGI: 3641861

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4778 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location174643534-174710832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174646807 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1092 (T1092A)
Ref Sequence ENSEMBL: ENSMUSP00000060255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059452]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059452
AA Change: T1092A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000060255
Gene: ENSMUSG00000050600
AA Change: T1092A

DomainStartEndE-ValueType
low complexity region 120 135 N/A INTRINSIC
ZnF_C2H2 143 165 5.06e-2 SMART
ZnF_C2H2 171 195 7.78e-3 SMART
low complexity region 201 216 N/A INTRINSIC
low complexity region 237 248 N/A INTRINSIC
low complexity region 345 371 N/A INTRINSIC
low complexity region 383 392 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 1520 1529 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T C 4: 107,891,998 V64A probably damaging Het
4932438A13Rik T A 3: 36,937,065 M897K possibly damaging Het
Abcc10 T C 17: 46,304,416 N1349S probably damaging Het
AF529169 T A 9: 89,603,102 I81F probably damaging Het
Ahnak T C 19: 9,011,975 V3541A possibly damaging Het
Arhgap33 T A 7: 30,532,093 T156S probably benign Het
Card11 G T 5: 140,883,782 probably null Het
Cdh3 T A 8: 106,543,826 I445N probably damaging Het
Csrp3 T G 7: 48,832,563 K169N probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Erc1 A T 6: 119,797,337 probably null Het
Fat1 T C 8: 45,038,326 V3808A probably benign Het
Fbxw19 T C 9: 109,494,646 D87G probably damaging Het
Gm1123 T C 9: 99,018,507 I99V probably benign Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5045 T A 15: 59,211,403 noncoding transcript Het
Hand1 T C 11: 57,831,623 D55G possibly damaging Het
Lrguk T A 6: 34,056,080 I227K probably damaging Het
Mdn1 C T 4: 32,683,583 R726* probably null Het
Myo16 T A 8: 10,569,694 V1415E probably damaging Het
Myof T C 19: 37,949,563 D901G probably damaging Het
Naip1 A G 13: 100,426,648 Y670H probably damaging Het
Nmd3 T A 3: 69,731,591 Y171* probably null Het
Notch4 C T 17: 34,582,511 A1111V possibly damaging Het
Nphp4 T A 4: 152,556,291 D1038E probably benign Het
Olfr484 A T 7: 108,124,480 I261N possibly damaging Het
Olfr694 A C 7: 106,689,667 S21R probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pcsk6 G A 7: 65,959,145 G252R probably damaging Het
Pole T G 5: 110,330,832 H15Q probably benign Het
Pstpip1 A G 9: 56,128,620 D383G possibly damaging Het
Ptprq T C 10: 107,591,022 T1551A probably benign Het
Rasgrf2 A G 13: 91,983,661 F626L probably damaging Het
Retreg1 C A 15: 25,971,785 N394K possibly damaging Het
Rpp14 T A 14: 8,090,203 D42E probably benign Het
Rrp8 T A 7: 105,737,274 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Snx1 T C 9: 66,101,416 probably benign Het
Stau1 A T 2: 166,963,522 N51K probably benign Het
Tdrd5 T A 1: 156,255,587 D960V probably damaging Het
Tex10 T C 4: 48,436,468 D750G probably damaging Het
Tmem43 T C 6: 91,482,255 V236A probably damaging Het
Tmem89 T C 9: 108,915,375 V112A probably damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Vmn1r41 A C 6: 89,747,275 K266T probably damaging Het
Vmn2r65 T C 7: 84,943,593 K469E possibly damaging Het
Zfp981 T A 4: 146,537,655 S346T probably benign Het
Other mutations in Zfp831
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Zfp831 APN 2 174646285 missense possibly damaging 0.86
IGL00091:Zfp831 APN 2 174645658 missense possibly damaging 0.73
IGL00764:Zfp831 APN 2 174645908 missense possibly damaging 0.72
IGL01538:Zfp831 APN 2 174644606 missense possibly damaging 0.72
IGL01700:Zfp831 APN 2 174644918 missense possibly damaging 0.86
IGL01718:Zfp831 APN 2 174643838 missense possibly damaging 0.86
IGL02221:Zfp831 APN 2 174643726 missense probably benign 0.33
IGL02250:Zfp831 APN 2 174648201 missense possibly damaging 0.53
IGL03209:Zfp831 APN 2 174645266 missense probably benign 0.40
D4043:Zfp831 UTSW 2 174645266 missense probably benign 0.40
FR4304:Zfp831 UTSW 2 174645481 small insertion probably benign
FR4340:Zfp831 UTSW 2 174645480 small insertion probably benign
FR4449:Zfp831 UTSW 2 174645471 small insertion probably benign
FR4449:Zfp831 UTSW 2 174645482 small insertion probably benign
FR4589:Zfp831 UTSW 2 174645468 small insertion probably benign
FR4737:Zfp831 UTSW 2 174645471 small insertion probably benign
FR4737:Zfp831 UTSW 2 174645476 small insertion probably benign
FR4737:Zfp831 UTSW 2 174645483 small insertion probably benign
IGL02802:Zfp831 UTSW 2 174645152 missense possibly damaging 0.73
P0028:Zfp831 UTSW 2 174645346 missense possibly damaging 0.53
PIT4531001:Zfp831 UTSW 2 174646723 missense possibly damaging 0.90
R0631:Zfp831 UTSW 2 174645290 missense possibly damaging 0.53
R0644:Zfp831 UTSW 2 174645863 missense probably benign 0.33
R0782:Zfp831 UTSW 2 174646630 missense probably benign 0.06
R1156:Zfp831 UTSW 2 174646917 missense possibly damaging 0.53
R1280:Zfp831 UTSW 2 174704059 missense probably benign 0.00
R1709:Zfp831 UTSW 2 174645890 missense probably benign 0.33
R1883:Zfp831 UTSW 2 174704077 missense possibly damaging 0.53
R1884:Zfp831 UTSW 2 174704077 missense possibly damaging 0.53
R2127:Zfp831 UTSW 2 174648124 missense probably benign 0.33
R2137:Zfp831 UTSW 2 174705746 missense possibly damaging 0.53
R2268:Zfp831 UTSW 2 174644241 missense probably benign 0.01
R2330:Zfp831 UTSW 2 174648089 nonsense probably null
R3547:Zfp831 UTSW 2 174657683 missense probably benign
R3821:Zfp831 UTSW 2 174644023 missense possibly damaging 0.73
R4163:Zfp831 UTSW 2 174644029 missense possibly damaging 0.53
R4232:Zfp831 UTSW 2 174705654 missense possibly damaging 0.96
R4820:Zfp831 UTSW 2 174705304 missense possibly damaging 0.73
R4912:Zfp831 UTSW 2 174644624 missense probably damaging 1.00
R5119:Zfp831 UTSW 2 174705310 missense probably benign 0.18
R5152:Zfp831 UTSW 2 174644564 missense probably benign 0.33
R5723:Zfp831 UTSW 2 174645407 missense probably benign 0.23
R5741:Zfp831 UTSW 2 174645152 missense possibly damaging 0.73
R5888:Zfp831 UTSW 2 174643627 missense probably benign 0.18
R5975:Zfp831 UTSW 2 174644092 missense possibly damaging 0.93
R6092:Zfp831 UTSW 2 174705506 missense probably damaging 0.98
R6158:Zfp831 UTSW 2 174643858 missense possibly damaging 0.53
R6212:Zfp831 UTSW 2 174645868 missense possibly damaging 0.53
R6233:Zfp831 UTSW 2 174646697 missense possibly damaging 0.85
R6248:Zfp831 UTSW 2 174644515 missense possibly damaging 0.53
R6255:Zfp831 UTSW 2 174646421 missense possibly damaging 0.96
R6460:Zfp831 UTSW 2 174646567 missense possibly damaging 0.46
R6477:Zfp831 UTSW 2 174704167 missense probably benign
R6864:Zfp831 UTSW 2 174646740 missense possibly damaging 0.72
R7396:Zfp831 UTSW 2 174645209 missense possibly damaging 0.73
R7447:Zfp831 UTSW 2 174646103 missense possibly damaging 0.88
R7499:Zfp831 UTSW 2 174644023 missense possibly damaging 0.73
R7662:Zfp831 UTSW 2 174646141 missense possibly damaging 0.85
R7857:Zfp831 UTSW 2 174705242 missense probably benign 0.33
R7889:Zfp831 UTSW 2 174645304 missense possibly damaging 0.53
R7896:Zfp831 UTSW 2 174647128 missense possibly damaging 0.53
R8074:Zfp831 UTSW 2 174644735 missense possibly damaging 0.72
R8089:Zfp831 UTSW 2 174644924 missense possibly damaging 0.96
R8438:Zfp831 UTSW 2 174645003 missense possibly damaging 0.53
X0021:Zfp831 UTSW 2 174705869 missense possibly damaging 0.85
Z1177:Zfp831 UTSW 2 174644188 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGATAGCCTCCGTTCTGTCTAC -3'
(R):5'- ACTTAAGCAACACCATGTGAGC -3'

Sequencing Primer
(F):5'- GTTCTGTCTACTCACACCTGTG -3'
(R):5'- ACACCATGTGAGCTGGGGTTC -3'
Posted On2015-12-29