Incidental Mutation 'R4778:Olfr694'
ID368086
Institutional Source Beutler Lab
Gene Symbol Olfr694
Ensembl Gene ENSMUSG00000064223
Gene Nameolfactory receptor 694
SynonymsMOR283-9, GA_x6K02T2PBJ9-9067220-9066273
MMRRC Submission 042414-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R4778 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106684980-106691814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 106689667 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 21 (S21R)
Ref Sequence ENSEMBL: ENSMUSP00000151027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052535] [ENSMUST00000082091] [ENSMUST00000216118] [ENSMUST00000216895]
Predicted Effect probably damaging
Transcript: ENSMUST00000052535
AA Change: S21R

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000057180
Gene: ENSMUSG00000064223
AA Change: S21R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.1e-43 PFAM
Pfam:7tm_1 41 290 9.1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082091
AA Change: S21R

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080740
Gene: ENSMUSG00000064223
AA Change: S21R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.6e-6 PFAM
Pfam:7tm_1 41 290 7.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208331
Predicted Effect probably damaging
Transcript: ENSMUST00000216118
AA Change: S21R

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000216895
AA Change: S21R

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.2798 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T C 4: 107,891,998 V64A probably damaging Het
4932438A13Rik T A 3: 36,937,065 M897K possibly damaging Het
Abcc10 T C 17: 46,304,416 N1349S probably damaging Het
AF529169 T A 9: 89,603,102 I81F probably damaging Het
Ahnak T C 19: 9,011,975 V3541A possibly damaging Het
Arhgap33 T A 7: 30,532,093 T156S probably benign Het
Card11 G T 5: 140,883,782 probably null Het
Cdh3 T A 8: 106,543,826 I445N probably damaging Het
Csrp3 T G 7: 48,832,563 K169N probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Erc1 A T 6: 119,797,337 probably null Het
Fat1 T C 8: 45,038,326 V3808A probably benign Het
Fbxw19 T C 9: 109,494,646 D87G probably damaging Het
Gm1123 T C 9: 99,018,507 I99V probably benign Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5045 T A 15: 59,211,403 noncoding transcript Het
Hand1 T C 11: 57,831,623 D55G possibly damaging Het
Lrguk T A 6: 34,056,080 I227K probably damaging Het
Mdn1 C T 4: 32,683,583 R726* probably null Het
Myo16 T A 8: 10,569,694 V1415E probably damaging Het
Myof T C 19: 37,949,563 D901G probably damaging Het
Naip1 A G 13: 100,426,648 Y670H probably damaging Het
Nmd3 T A 3: 69,731,591 Y171* probably null Het
Notch4 C T 17: 34,582,511 A1111V possibly damaging Het
Nphp4 T A 4: 152,556,291 D1038E probably benign Het
Olfr484 A T 7: 108,124,480 I261N possibly damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pcsk6 G A 7: 65,959,145 G252R probably damaging Het
Pole T G 5: 110,330,832 H15Q probably benign Het
Pstpip1 A G 9: 56,128,620 D383G possibly damaging Het
Ptprq T C 10: 107,591,022 T1551A probably benign Het
Rasgrf2 A G 13: 91,983,661 F626L probably damaging Het
Retreg1 C A 15: 25,971,785 N394K possibly damaging Het
Rpp14 T A 14: 8,090,203 D42E probably benign Het
Rrp8 T A 7: 105,737,274 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Snx1 T C 9: 66,101,416 probably benign Het
Stau1 A T 2: 166,963,522 N51K probably benign Het
Tdrd5 T A 1: 156,255,587 D960V probably damaging Het
Tex10 T C 4: 48,436,468 D750G probably damaging Het
Tmem43 T C 6: 91,482,255 V236A probably damaging Het
Tmem89 T C 9: 108,915,375 V112A probably damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Vmn1r41 A C 6: 89,747,275 K266T probably damaging Het
Vmn2r65 T C 7: 84,943,593 K469E possibly damaging Het
Zfp831 A G 2: 174,646,807 T1092A possibly damaging Het
Zfp981 T A 4: 146,537,655 S346T probably benign Het
Other mutations in Olfr694
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr694 APN 7 106689531 missense probably damaging 1.00
IGL01759:Olfr694 APN 7 106689333 missense probably benign 0.04
IGL02435:Olfr694 APN 7 106689503 missense probably benign 0.26
IGL02569:Olfr694 APN 7 106689642 missense probably benign 0.19
IGL02611:Olfr694 APN 7 106688789 missense probably benign 0.11
IGL02726:Olfr694 APN 7 106689370 nonsense probably null
IGL02944:Olfr694 APN 7 106689269 missense probably damaging 1.00
IGL03155:Olfr694 APN 7 106689239 missense probably damaging 1.00
R0238:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0238:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0239:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0239:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0609:Olfr694 UTSW 7 106688998 missense probably damaging 1.00
R0655:Olfr694 UTSW 7 106689425 missense probably damaging 1.00
R1562:Olfr694 UTSW 7 106688980 missense probably benign 0.01
R1641:Olfr694 UTSW 7 106689711 missense probably benign 0.36
R2144:Olfr694 UTSW 7 106688957 missense probably damaging 0.99
R4416:Olfr694 UTSW 7 106689011 missense probably benign 0.07
R4444:Olfr694 UTSW 7 106689146 missense possibly damaging 0.60
R4445:Olfr694 UTSW 7 106689146 missense possibly damaging 0.60
R4567:Olfr694 UTSW 7 106689213 nonsense probably null
R4739:Olfr694 UTSW 7 106689144 nonsense probably null
R4908:Olfr694 UTSW 7 106689533 missense probably damaging 1.00
R5244:Olfr694 UTSW 7 106689189 missense probably benign 0.12
R5944:Olfr694 UTSW 7 106689646 nonsense probably null
R6260:Olfr694 UTSW 7 106688872 missense probably damaging 1.00
R6573:Olfr694 UTSW 7 106689463 missense probably benign 0.00
R6901:Olfr694 UTSW 7 106689189 missense probably benign 0.03
R7230:Olfr694 UTSW 7 106689524 missense possibly damaging 0.94
R7420:Olfr694 UTSW 7 106689020 missense possibly damaging 0.74
R7426:Olfr694 UTSW 7 106689210 missense possibly damaging 0.88
U24488:Olfr694 UTSW 7 106689089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTGAAGGGCACATCC -3'
(R):5'- AACCCTTGTTCTTAAGAGGCATACTG -3'

Sequencing Primer
(F):5'- CATCCCCCAAATGAGATAGTGTTATC -3'
(R):5'- GTTCTTAAGAGGCATACTGGGTAAC -3'
Posted On2015-12-29