Incidental Mutation 'R4778:AF529169'
ID368093
Institutional Source Beutler Lab
Gene Symbol AF529169
Ensembl Gene ENSMUSG00000039313
Gene NamecDNA sequence AF529169
SynonymsDD1
MMRRC Submission 042414-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4778 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location89587216-89623125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89603102 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 81 (I81F)
Ref Sequence ENSEMBL: ENSMUSP00000140942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044491] [ENSMUST00000191465]
Predicted Effect probably damaging
Transcript: ENSMUST00000044491
AA Change: I81F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046111
Gene: ENSMUSG00000039313
AA Change: I81F

DomainStartEndE-ValueType
low complexity region 508 522 N/A INTRINSIC
Pfam:UPF0258 760 915 8.7e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191465
AA Change: I81F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140942
Gene: ENSMUSG00000039313
AA Change: I81F

DomainStartEndE-ValueType
low complexity region 508 522 N/A INTRINSIC
Pfam:UPF0258 759 854 6.1e-38 PFAM
Meta Mutation Damage Score 0.4093 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T C 4: 107,891,998 V64A probably damaging Het
4932438A13Rik T A 3: 36,937,065 M897K possibly damaging Het
Abcc10 T C 17: 46,304,416 N1349S probably damaging Het
Ahnak T C 19: 9,011,975 V3541A possibly damaging Het
Arhgap33 T A 7: 30,532,093 T156S probably benign Het
Card11 G T 5: 140,883,782 probably null Het
Cdh3 T A 8: 106,543,826 I445N probably damaging Het
Csrp3 T G 7: 48,832,563 K169N probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Erc1 A T 6: 119,797,337 probably null Het
Fat1 T C 8: 45,038,326 V3808A probably benign Het
Fbxw19 T C 9: 109,494,646 D87G probably damaging Het
Gm1123 T C 9: 99,018,507 I99V probably benign Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5045 T A 15: 59,211,403 noncoding transcript Het
Hand1 T C 11: 57,831,623 D55G possibly damaging Het
Lrguk T A 6: 34,056,080 I227K probably damaging Het
Mdn1 C T 4: 32,683,583 R726* probably null Het
Myo16 T A 8: 10,569,694 V1415E probably damaging Het
Myof T C 19: 37,949,563 D901G probably damaging Het
Naip1 A G 13: 100,426,648 Y670H probably damaging Het
Nmd3 T A 3: 69,731,591 Y171* probably null Het
Notch4 C T 17: 34,582,511 A1111V possibly damaging Het
Nphp4 T A 4: 152,556,291 D1038E probably benign Het
Olfr484 A T 7: 108,124,480 I261N possibly damaging Het
Olfr694 A C 7: 106,689,667 S21R probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pcsk6 G A 7: 65,959,145 G252R probably damaging Het
Pole T G 5: 110,330,832 H15Q probably benign Het
Pstpip1 A G 9: 56,128,620 D383G possibly damaging Het
Ptprq T C 10: 107,591,022 T1551A probably benign Het
Rasgrf2 A G 13: 91,983,661 F626L probably damaging Het
Retreg1 C A 15: 25,971,785 N394K possibly damaging Het
Rpp14 T A 14: 8,090,203 D42E probably benign Het
Rrp8 T A 7: 105,737,274 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Snx1 T C 9: 66,101,416 probably benign Het
Stau1 A T 2: 166,963,522 N51K probably benign Het
Tdrd5 T A 1: 156,255,587 D960V probably damaging Het
Tex10 T C 4: 48,436,468 D750G probably damaging Het
Tmem43 T C 6: 91,482,255 V236A probably damaging Het
Tmem89 T C 9: 108,915,375 V112A probably damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Vmn1r41 A C 6: 89,747,275 K266T probably damaging Het
Vmn2r65 T C 7: 84,943,593 K469E possibly damaging Het
Zfp831 A G 2: 174,646,807 T1092A possibly damaging Het
Zfp981 T A 4: 146,537,655 S346T probably benign Het
Other mutations in AF529169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:AF529169 APN 9 89601800 missense probably benign 0.02
IGL00163:AF529169 APN 9 89591097 unclassified probably benign
IGL00336:AF529169 APN 9 89603143 missense probably damaging 1.00
IGL01608:AF529169 APN 9 89596498 missense probably benign 0.15
IGL01818:AF529169 APN 9 89601313 missense probably damaging 0.99
IGL02012:AF529169 APN 9 89601438 missense probably benign 0.01
IGL02259:AF529169 APN 9 89602359 missense possibly damaging 0.93
IGL02894:AF529169 APN 9 89603102 missense probably damaging 0.99
IGL03008:AF529169 APN 9 89596678 missense probably damaging 1.00
IGL02988:AF529169 UTSW 9 89602739 missense probably benign 0.02
R0410:AF529169 UTSW 9 89602203 missense probably damaging 0.97
R0825:AF529169 UTSW 9 89603279 nonsense probably null
R0883:AF529169 UTSW 9 89602417 missense probably benign 0.05
R0989:AF529169 UTSW 9 89602035 missense probably damaging 0.99
R1376:AF529169 UTSW 9 89591246 missense probably damaging 1.00
R1376:AF529169 UTSW 9 89591246 missense probably damaging 1.00
R1632:AF529169 UTSW 9 89602360 missense probably damaging 0.96
R1804:AF529169 UTSW 9 89603099 missense possibly damaging 0.91
R1974:AF529169 UTSW 9 89601203 missense probably damaging 1.00
R2151:AF529169 UTSW 9 89602168 missense possibly damaging 0.53
R2882:AF529169 UTSW 9 89602802 missense possibly damaging 0.86
R2909:AF529169 UTSW 9 89591278 missense probably damaging 1.00
R3961:AF529169 UTSW 9 89601910 missense probably damaging 1.00
R3962:AF529169 UTSW 9 89601910 missense probably damaging 1.00
R3963:AF529169 UTSW 9 89601910 missense probably damaging 1.00
R4676:AF529169 UTSW 9 89601553 missense probably damaging 1.00
R4931:AF529169 UTSW 9 89601652 missense probably benign 0.05
R5300:AF529169 UTSW 9 89603199 missense probably damaging 1.00
R5702:AF529169 UTSW 9 89591155 missense probably benign 0.22
R5759:AF529169 UTSW 9 89601072 missense probably benign 0.01
R6187:AF529169 UTSW 9 89591167 missense probably damaging 1.00
R7320:AF529169 UTSW 9 89601626 missense probably benign
R7542:AF529169 UTSW 9 89601911 missense probably damaging 1.00
R7552:AF529169 UTSW 9 89601835 missense probably benign 0.00
U24488:AF529169 UTSW 9 89603047 missense probably damaging 1.00
Z1177:AF529169 UTSW 9 89603162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATTTGGATGACTGCCTG -3'
(R):5'- ACTGTTTCCTATCAAGACCTGTGC -3'

Sequencing Primer
(F):5'- TCAGCTCACAGTTCAGAGGCTC -3'
(R):5'- AGACCTGTGCAAGTCACTCTGTG -3'
Posted On2015-12-29