Incidental Mutation 'R4778:Tmem89'
ID368095
Institutional Source Beutler Lab
Gene Symbol Tmem89
Ensembl Gene ENSMUSG00000025652
Gene Nametransmembrane protein 89
Synonyms1700024B07Rik
MMRRC Submission 042414-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R4778 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108914619-108915563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108915375 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 112 (V112A)
Ref Sequence ENSEMBL: ENSMUSP00000026744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026744] [ENSMUST00000098376] [ENSMUST00000192852]
Predicted Effect probably damaging
Transcript: ENSMUST00000026744
AA Change: V112A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026744
Gene: ENSMUSG00000025652
AA Change: V112A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM89 23 47 6.3e-16 PFAM
Pfam:TMEM89 46 166 1.1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098376
SMART Domains Protein: ENSMUSP00000095979
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_transp 69 458 4.4e-113 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 2e-16 PDB
low complexity region 554 593 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191404
Predicted Effect probably benign
Transcript: ENSMUST00000192852
SMART Domains Protein: ENSMUSP00000142016
Gene: ENSMUSG00000025652

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM89 23 47 1.8e-15 PFAM
Pfam:TMEM89 45 118 1.3e-37 PFAM
Meta Mutation Damage Score 0.1059 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T C 4: 107,891,998 V64A probably damaging Het
4932438A13Rik T A 3: 36,937,065 M897K possibly damaging Het
Abcc10 T C 17: 46,304,416 N1349S probably damaging Het
AF529169 T A 9: 89,603,102 I81F probably damaging Het
Ahnak T C 19: 9,011,975 V3541A possibly damaging Het
Arhgap33 T A 7: 30,532,093 T156S probably benign Het
Card11 G T 5: 140,883,782 probably null Het
Cdh3 T A 8: 106,543,826 I445N probably damaging Het
Csrp3 T G 7: 48,832,563 K169N probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Erc1 A T 6: 119,797,337 probably null Het
Fat1 T C 8: 45,038,326 V3808A probably benign Het
Fbxw19 T C 9: 109,494,646 D87G probably damaging Het
Gm1123 T C 9: 99,018,507 I99V probably benign Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5045 T A 15: 59,211,403 noncoding transcript Het
Hand1 T C 11: 57,831,623 D55G possibly damaging Het
Lrguk T A 6: 34,056,080 I227K probably damaging Het
Mdn1 C T 4: 32,683,583 R726* probably null Het
Myo16 T A 8: 10,569,694 V1415E probably damaging Het
Myof T C 19: 37,949,563 D901G probably damaging Het
Naip1 A G 13: 100,426,648 Y670H probably damaging Het
Nmd3 T A 3: 69,731,591 Y171* probably null Het
Notch4 C T 17: 34,582,511 A1111V possibly damaging Het
Nphp4 T A 4: 152,556,291 D1038E probably benign Het
Olfr484 A T 7: 108,124,480 I261N possibly damaging Het
Olfr694 A C 7: 106,689,667 S21R probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pcsk6 G A 7: 65,959,145 G252R probably damaging Het
Pole T G 5: 110,330,832 H15Q probably benign Het
Pstpip1 A G 9: 56,128,620 D383G possibly damaging Het
Ptprq T C 10: 107,591,022 T1551A probably benign Het
Rasgrf2 A G 13: 91,983,661 F626L probably damaging Het
Retreg1 C A 15: 25,971,785 N394K possibly damaging Het
Rpp14 T A 14: 8,090,203 D42E probably benign Het
Rrp8 T A 7: 105,737,274 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Snx1 T C 9: 66,101,416 probably benign Het
Stau1 A T 2: 166,963,522 N51K probably benign Het
Tdrd5 T A 1: 156,255,587 D960V probably damaging Het
Tex10 T C 4: 48,436,468 D750G probably damaging Het
Tmem43 T C 6: 91,482,255 V236A probably damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Vmn1r41 A C 6: 89,747,275 K266T probably damaging Het
Vmn2r65 T C 7: 84,943,593 K469E possibly damaging Het
Zfp831 A G 2: 174,646,807 T1092A possibly damaging Het
Zfp981 T A 4: 146,537,655 S346T probably benign Het
Other mutations in Tmem89
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0060:Tmem89 UTSW 9 108915417 missense probably damaging 1.00
R0060:Tmem89 UTSW 9 108915417 missense probably damaging 1.00
R0063:Tmem89 UTSW 9 108914812 missense probably benign 0.00
R0063:Tmem89 UTSW 9 108914812 missense probably benign 0.00
R2447:Tmem89 UTSW 9 108914800 missense probably damaging 0.98
R4906:Tmem89 UTSW 9 108914761 unclassified probably benign
R5529:Tmem89 UTSW 9 108915477 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACTAGTCCTCTGGTCCATCTG -3'
(R):5'- GAGAAGCATATATTGGGTCACCC -3'

Sequencing Primer
(F):5'- ATTCTTCATCCAGCCACCATGGG -3'
(R):5'- GGGTCACCCAGACTGAGG -3'
Posted On2015-12-29