Incidental Mutation 'R4778:Hand1'
ID368099
Institutional Source Beutler Lab
Gene Symbol Hand1
Ensembl Gene ENSMUSG00000037335
Gene Nameheart and neural crest derivatives expressed 1
SynonymsHxt, Th1, eHAND, bHLHa27, Ehand1, Thing1
MMRRC Submission 042414-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4778 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location57828705-57832818 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57831623 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 55 (D55G)
Ref Sequence ENSEMBL: ENSMUSP00000124951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036917] [ENSMUST00000108845] [ENSMUST00000160392]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036917
AA Change: D55G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046999
Gene: ENSMUSG00000037335
AA Change: D55G

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 49 78 N/A INTRINSIC
HLH 100 152 1.03e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108845
Predicted Effect possibly damaging
Transcript: ENSMUST00000160392
AA Change: D55G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124951
Gene: ENSMUSG00000037335
AA Change: D55G

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 49 78 N/A INTRINSIC
HLH 100 152 1.03e-16 SMART
Meta Mutation Damage Score 0.0875 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, it has been suggested that this transcription factor may be required for early trophoblast differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 8.5-9.5 with yolk sac abnormalities associated with a deficiency of extraembryonic mesoderm and defective trophoblast differentiation. Tetraploid chimeric rescue slightly extends development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T C 4: 107,891,998 V64A probably damaging Het
4932438A13Rik T A 3: 36,937,065 M897K possibly damaging Het
Abcc10 T C 17: 46,304,416 N1349S probably damaging Het
AF529169 T A 9: 89,603,102 I81F probably damaging Het
Ahnak T C 19: 9,011,975 V3541A possibly damaging Het
Arhgap33 T A 7: 30,532,093 T156S probably benign Het
Card11 G T 5: 140,883,782 probably null Het
Cdh3 T A 8: 106,543,826 I445N probably damaging Het
Csrp3 T G 7: 48,832,563 K169N probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Erc1 A T 6: 119,797,337 probably null Het
Fat1 T C 8: 45,038,326 V3808A probably benign Het
Fbxw19 T C 9: 109,494,646 D87G probably damaging Het
Gm1123 T C 9: 99,018,507 I99V probably benign Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5045 T A 15: 59,211,403 noncoding transcript Het
Lrguk T A 6: 34,056,080 I227K probably damaging Het
Mdn1 C T 4: 32,683,583 R726* probably null Het
Myo16 T A 8: 10,569,694 V1415E probably damaging Het
Myof T C 19: 37,949,563 D901G probably damaging Het
Naip1 A G 13: 100,426,648 Y670H probably damaging Het
Nmd3 T A 3: 69,731,591 Y171* probably null Het
Notch4 C T 17: 34,582,511 A1111V possibly damaging Het
Nphp4 T A 4: 152,556,291 D1038E probably benign Het
Olfr484 A T 7: 108,124,480 I261N possibly damaging Het
Olfr694 A C 7: 106,689,667 S21R probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pcsk6 G A 7: 65,959,145 G252R probably damaging Het
Pole T G 5: 110,330,832 H15Q probably benign Het
Pstpip1 A G 9: 56,128,620 D383G possibly damaging Het
Ptprq T C 10: 107,591,022 T1551A probably benign Het
Rasgrf2 A G 13: 91,983,661 F626L probably damaging Het
Retreg1 C A 15: 25,971,785 N394K possibly damaging Het
Rpp14 T A 14: 8,090,203 D42E probably benign Het
Rrp8 T A 7: 105,737,274 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Snx1 T C 9: 66,101,416 probably benign Het
Stau1 A T 2: 166,963,522 N51K probably benign Het
Tdrd5 T A 1: 156,255,587 D960V probably damaging Het
Tex10 T C 4: 48,436,468 D750G probably damaging Het
Tmem43 T C 6: 91,482,255 V236A probably damaging Het
Tmem89 T C 9: 108,915,375 V112A probably damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Vmn1r41 A C 6: 89,747,275 K266T probably damaging Het
Vmn2r65 T C 7: 84,943,593 K469E possibly damaging Het
Zfp831 A G 2: 174,646,807 T1092A possibly damaging Het
Zfp981 T A 4: 146,537,655 S346T probably benign Het
Other mutations in Hand1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Hand1 APN 11 57831749 missense probably damaging 1.00
IGL02484:Hand1 APN 11 57831594 missense probably benign
R0724:Hand1 UTSW 11 57831680 missense probably damaging 1.00
R4934:Hand1 UTSW 11 57831252 missense possibly damaging 0.91
R5212:Hand1 UTSW 11 57831447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATTGGGGATGCACTCAC -3'
(R):5'- TGCTAATTGGGCTGACAGC -3'

Sequencing Primer
(F):5'- GATGCACTCACGCAGCTC -3'
(R):5'- TGACAGCACAGGCCAGG -3'
Posted On2015-12-29